ID: 1122781946

View in Genome Browser
Species Human (GRCh38)
Location 14:104147445-104147467
Sequence CTGTGGGTCTGCAGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 385}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122781946_1122781953 -5 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781953 14:104147463-104147485 CACAGGATGGGAATGGTCCCTGG 0: 1
1: 0
2: 0
3: 24
4: 255
1122781946_1122781959 17 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781959 14:104147485-104147507 GAGTCCTGGCTGGCAGACCAGGG 0: 1
1: 0
2: 0
3: 15
4: 240
1122781946_1122781960 20 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781960 14:104147488-104147510 TCCTGGCTGGCAGACCAGGGAGG 0: 1
1: 0
2: 4
3: 29
4: 274
1122781946_1122781955 7 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781955 14:104147475-104147497 ATGGTCCCTGGAGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 29
4: 222
1122781946_1122781964 27 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781964 14:104147495-104147517 TGGCAGACCAGGGAGGGTCTGGG 0: 1
1: 0
2: 4
3: 46
4: 338
1122781946_1122781958 16 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781958 14:104147484-104147506 GGAGTCCTGGCTGGCAGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 336
1122781946_1122781954 3 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781954 14:104147471-104147493 GGGAATGGTCCCTGGAGTCCTGG 0: 1
1: 0
2: 0
3: 27
4: 387
1122781946_1122781962 21 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781962 14:104147489-104147511 CCTGGCTGGCAGACCAGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 383
1122781946_1122781963 26 Left 1122781946 14:104147445-104147467 CCTTCAGAGCTGCAGACCCACAG 0: 1
1: 0
2: 3
3: 33
4: 385
Right 1122781963 14:104147494-104147516 CTGGCAGACCAGGGAGGGTCTGG 0: 1
1: 0
2: 2
3: 45
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122781946 Original CRISPR CTGTGGGTCTGCAGCTCTGA AGG (reversed) Intronic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG + Intergenic
901051205 1:6426677-6426699 CTGTGGGTCTGAAGCTCCAGGGG - Intronic
902981589 1:20127204-20127226 CTGAGAGTCTGCAGCTTTGGGGG + Intergenic
903035720 1:20491406-20491428 CTCTGGGCTTGGAGCTCTGAGGG + Intergenic
904066207 1:27753423-27753445 ATGTGAGACTGCAGCTCTAAGGG + Intronic
904824639 1:33266376-33266398 CTCTGGGGCTGCAGCAGTGACGG + Intronic
904870228 1:33612973-33612995 CTGTGGGCCTGCAGCCCGCAGGG - Intronic
904983845 1:34528296-34528318 CTGTTGGTCTGCAGCACTCGTGG - Intergenic
905093751 1:35451055-35451077 CTGGAGGTCTGCATATCTGATGG + Intronic
908913147 1:69096240-69096262 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
909227287 1:73041881-73041903 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
911516551 1:98874801-98874823 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
912424789 1:109577727-109577749 CTCTGGGTCTCCAGCTCTAATGG - Intronic
912776449 1:112508985-112509007 CAGGGGGTCTGCGGCGCTGAAGG - Exonic
912820843 1:112866487-112866509 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
913296046 1:117321340-117321362 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
913416234 1:118611730-118611752 CTGTTGGTCTGCTGGTCTGCTGG + Intergenic
914502957 1:148263684-148263706 CTATGGGTTTGTAGCTTTGACGG + Intergenic
917478532 1:175389612-175389634 CTTTGGGTCTTCATTTCTGAAGG + Intronic
918269595 1:182884757-182884779 CTGAGGGTCTAGAGATCTGACGG - Exonic
918940191 1:190984374-190984396 CTTAGGGTTTCCAGCTCTGAGGG + Intergenic
919429175 1:197471511-197471533 CTGTCGGCCTGCTGCTCAGAGGG + Intronic
919906431 1:202081648-202081670 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
920576928 1:207068308-207068330 CTGTGAGTAGGAAGCTCTGAAGG + Exonic
920770146 1:208876474-208876496 CTGTGGCCCAGCTGCTCTGAAGG + Intergenic
920815693 1:209329605-209329627 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
922054698 1:222029640-222029662 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
923100395 1:230809623-230809645 CTGTGGGTCAGAAGCTGTGCTGG - Intergenic
923227893 1:231956274-231956296 CTTGGGGTCTTCATCTCTGAAGG + Intronic
923430137 1:233912072-233912094 CTCTGGCCCTGCAGCCCTGAGGG + Intronic
923511581 1:234658147-234658169 ATCTGGGCCTGCAGCTCTCAGGG + Intergenic
924077898 1:240360315-240360337 CTGTTGGTTTGCAGATGTGATGG - Intronic
924544974 1:245018406-245018428 GTATGGTGCTGCAGCTCTGATGG - Intronic
924670530 1:246119971-246119993 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1063159024 10:3406321-3406343 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1064056001 10:12097949-12097971 CTGTGCATCTGCAGCTCTCTTGG - Exonic
1064145425 10:12822954-12822976 CTGTGTGTTTGCAGCCCTGCTGG + Intronic
1064705552 10:18069431-18069453 CTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1065258827 10:23903436-23903458 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067452891 10:46393185-46393207 CTGTGGGTCAGCAGTTCTGGAGG + Intergenic
1067577827 10:47419215-47419237 CTGTCTGTCTGCAGCTCTCTGGG - Intergenic
1067584341 10:47466574-47466596 CTGTGGGTCAGCAGTTCTGGAGG - Intronic
1068299219 10:55117071-55117093 TTGGGGGTCTTCAGTTCTGAAGG + Intronic
1071827865 10:89343189-89343211 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1073138260 10:101231360-101231382 GAGTGGGTCTGCAGCTCTGAGGG - Intergenic
1074188506 10:111116419-111116441 TTTGGGGTCTCCAGCTCTGAAGG + Intergenic
1074828543 10:117232106-117232128 CCGTGGGCCTTCAGCTTTGATGG + Intergenic
1075441930 10:122486632-122486654 CAGTGGGTGTGAAGCTGTGACGG + Intronic
1075700802 10:124468480-124468502 CTGTGGGCCTGCAGAACCGATGG + Intronic
1076102464 10:127794114-127794136 CTGTGGGTTTGCAGACTTGAGGG - Intergenic
1076400803 10:130183780-130183802 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1076430538 10:130398863-130398885 CTGCGGGTCTTCAGCCTTGAGGG + Intergenic
1076664118 10:132076579-132076601 CTGTGGGGCCCCAGGTCTGACGG + Intergenic
1077501566 11:2911830-2911852 TTCTGGGTCAGCAGCTGTGATGG - Intronic
1079865683 11:25730579-25730601 CTTTGGGTCTTCATTTCTGAGGG - Intergenic
1080900477 11:36485481-36485503 CTTACTGTCTGCAGCTCTGAAGG - Intergenic
1081102889 11:39026909-39026931 CTCTAGGTCTTCTGCTCTGATGG + Intergenic
1081140767 11:39496205-39496227 ATGTGGGTTTGCATATCTGATGG + Intergenic
1081685111 11:45036888-45036910 CTGTGGGTGTGAAGCTCTCCAGG - Intergenic
1082128363 11:48457401-48457423 CTGTGGGCCTGCTGCTTGGAAGG + Intergenic
1082249051 11:49960028-49960050 CTGTGGGTCTGCCACTTGGAAGG - Intergenic
1082751472 11:57022802-57022824 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1083053357 11:59796357-59796379 CTGTGGTTATCCAGCTCTGGTGG + Intronic
1084025593 11:66446810-66446832 CCCTGGGAATGCAGCTCTGAAGG + Intronic
1084267711 11:68013343-68013365 CTGTGGGCCGGGAGCTCTGTGGG - Intronic
1085203042 11:74713260-74713282 TTGTGTGTCTACACCTCTGATGG + Intronic
1085253333 11:75157988-75158010 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1086810186 11:91300396-91300418 CTGGAGGTCTGCTGTTCTGAAGG + Intergenic
1087582454 11:100075478-100075500 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1087779354 11:102286622-102286644 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1088411469 11:109539358-109539380 CTGTGGGCCTGGAGCTGTGGTGG - Intergenic
1088893278 11:114060495-114060517 CAGAGGGTCTGCAGCGCTGCGGG + Intronic
1090540772 11:127700624-127700646 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1090599871 11:128358917-128358939 CTGTGAGTGTGAAGCGCTGAGGG + Intergenic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1093798900 12:23347709-23347731 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1095326651 12:40903128-40903150 CTGTGGGTCTCCATGACTGATGG - Intronic
1095392294 12:41721949-41721971 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1096287135 12:50309965-50309987 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1096339588 12:50786425-50786447 CTTTGTGTCTGCAGCTCCCAAGG - Intronic
1096566045 12:52480233-52480255 CTCTTGGTCTGCTGCTGTGAAGG - Intergenic
1097308339 12:58093233-58093255 CTCTGGGTCTTCATTTCTGAAGG + Intergenic
1097327573 12:58295990-58296012 CTTTGGGTCTTCAACTGTGAAGG + Intergenic
1097504372 12:60446461-60446483 CTTTGGGTCTGCATTTCTGAAGG - Intergenic
1098465644 12:70783642-70783664 CTCTGGGTCTGCAGGACTGGCGG + Intronic
1098557767 12:71838830-71838852 CTTGGGCTCTGCAGCTATGAGGG + Intergenic
1100776927 12:97985278-97985300 CTGACCGTCTGCAGCTCTGATGG + Intergenic
1100896951 12:99193519-99193541 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1100931081 12:99610163-99610185 CTGTGGGCCTTCATTTCTGAAGG - Intronic
1101315106 12:103621836-103621858 CTAAGGGTCTGAAGCTCTGCAGG - Intronic
1101976302 12:109362526-109362548 CTGTGGGTCTTCATTTCTGAAGG - Intronic
1103240701 12:119411073-119411095 CTTTGGGTCTCCATTTCTGAAGG - Intronic
1103904236 12:124319293-124319315 CTGTGGGGCAGCAGCTCTTGGGG + Intergenic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104196515 12:126544478-126544500 CCTTGGCTCTCCAGCTCTGAGGG - Intergenic
1104914751 12:132258845-132258867 CTGTGGGTCTCCAGCGTGGACGG - Intronic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1107557143 13:41526758-41526780 CTGTGTGCCTCCAGCTGTGATGG - Intergenic
1107987218 13:45785846-45785868 CAGTGTGTCTTCAGCTATGAAGG + Intronic
1108591247 13:51914719-51914741 CTGTGAGGCTGCTGCTCTGTGGG - Intergenic
1110985115 13:81957048-81957070 CTGTGGATATGCTTCTCTGATGG - Intergenic
1111580371 13:90214617-90214639 CTTTGGGTCTTCACTTCTGAAGG + Intergenic
1111585720 13:90281817-90281839 ATGTGGCTCTGCCTCTCTGAGGG - Intergenic
1111668124 13:91295647-91295669 CTGTGGGTATCCAGGCCTGAGGG - Intergenic
1112920256 13:104604027-104604049 CTGTGGGTCTTAAGCCTTGAGGG - Intergenic
1113056695 13:106275729-106275751 CAGTGGTTCTGCATATCTGAGGG - Intergenic
1114215595 14:20655546-20655568 AAGTGGGTCTGGATCTCTGAGGG + Intergenic
1114711325 14:24781296-24781318 CTGTGCCTCTGCAGGTCTGCTGG + Intergenic
1115282336 14:31678077-31678099 CTGTGGGTCTGTAGTGCTGGTGG - Intronic
1116478352 14:45367257-45367279 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1116636589 14:47404032-47404054 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1117515698 14:56499191-56499213 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1117895874 14:60485887-60485909 CTCTGGGCCGGCGGCTCTGAGGG - Intronic
1118981933 14:70724234-70724256 TTCTGGCTCTGCAGCCCTGAGGG - Intronic
1119477422 14:74939207-74939229 CTGTGGGTCTGCACAGCTGCAGG + Intergenic
1119642528 14:76325919-76325941 CTGTGGGTGTGCAGCACAGGCGG - Intronic
1121109760 14:91304079-91304101 CTCTGGGTCTTCTGCCCTGAGGG - Intronic
1121411176 14:93749178-93749200 CCGTGCGTCTGCAGCCCTGGTGG - Intronic
1121584895 14:95056601-95056623 CTGAGGTTCTGCTGCCCTGATGG - Intergenic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1122284328 14:100641883-100641905 GTGTCTGTCTGCAGCACTGAGGG - Intergenic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1123015125 14:105369787-105369809 CGGCGGGTCTGCAGCTCTGGCGG + Intronic
1123401501 15:19991239-19991261 CTGTGGGTCTGTAACTCACAGGG - Intergenic
1124200268 15:27673421-27673443 CTGCAGGTCTTCAGCTCTGAAGG + Intergenic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1128319871 15:66685606-66685628 CTGTCTGTCTGCAGCTCTGGAGG - Exonic
1128650877 15:69412738-69412760 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1129766725 15:78174356-78174378 CTGGGGGGCTCCAGCTCAGAAGG - Intronic
1131486510 15:92825381-92825403 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1132595253 16:746208-746230 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132595298 16:746383-746405 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132812934 16:1810416-1810438 CTGTGAGGCTGCAGCTGTGGCGG - Intronic
1133340266 16:5031366-5031388 CTCTGATTCTGCAGGTCTGAGGG + Intronic
1135148260 16:19982656-19982678 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1137586812 16:49668699-49668721 CTGTGGGTCTGCAGCGTTAGTGG - Intronic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1138656840 16:58496275-58496297 CTCCGGGGCTGCAGCTCAGAGGG - Intronic
1139474886 16:67198203-67198225 CTGTGGCTCTCAAGCTCTGTAGG - Exonic
1139535994 16:67574208-67574230 CAGTTGGTCAGAAGCTCTGAAGG - Intronic
1140402736 16:74684751-74684773 CTGTGGCTCAGCAGCACTTAGGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141381022 16:83577170-83577192 AAGTGAGTCTGCAGCTATGACGG - Intronic
1141610058 16:85176254-85176276 CTGTGGGTCTGCAGTTGTGGAGG + Intronic
1141924984 16:87162204-87162226 CTGTGGTTTTGCTGCTCTGCTGG - Intronic
1141993622 16:87623611-87623633 CTCGGGGTCTGCAGCTCCCAAGG - Intronic
1142016372 16:87750320-87750342 CTGTGGAGATGCAGCACTGAGGG - Intronic
1142028610 16:87827369-87827391 TGGTGGGGCTGCAGCTCTGTGGG + Intergenic
1143162819 17:4882394-4882416 CTCTGGGTCTGCACCTCCCAGGG - Intronic
1143406509 17:6681222-6681244 CTGTGGCTCTGCAGCTGGAAGGG + Intergenic
1144433411 17:15217125-15217147 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144745228 17:17609460-17609482 CTGTGGCTCTGCTGCCCTGTAGG - Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1148052921 17:44777946-44777968 CTCTAGGTCTGCAGCAATGAAGG + Exonic
1148080640 17:44966283-44966305 CTGCGGGTCTGCAAGTCTTAGGG - Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148560041 17:48600872-48600894 CTGTGAGTCTGCAGTCCTGTGGG + Intronic
1150605319 17:66685854-66685876 CTGTGGTTCTGCAACTTTTATGG + Intronic
1151320942 17:73352075-73352097 CTGTGTCTCTGCTGCTCTGCAGG + Intronic
1152687405 17:81701417-81701439 TTGTGGGTCTGTGGCTCTGCTGG + Intronic
1155429253 18:25738270-25738292 CTGAGGCTCTGCAGCTCTGCTGG + Intergenic
1155734124 18:29200138-29200160 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1156459370 18:37313046-37313068 GTGGGGGTCTCCGGCTCTGAGGG + Intronic
1156732433 18:40210673-40210695 CTTTGGGTCTTCAATTCTGAAGG - Intergenic
1157221267 18:45829768-45829790 CTGAGGGACTCCAGCTCTGAGGG + Intronic
1157418080 18:47522638-47522660 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1157532158 18:48430175-48430197 TTGTGGGTTTCCTGCTCTGAAGG + Intergenic
1157816016 18:50729877-50729899 CTGGGGGTCTCCTGCTCTGTGGG - Exonic
1160212793 18:76896689-76896711 CTGTGTGAGTGCAGCTCTGCAGG - Intronic
1160504252 18:79418124-79418146 CTGTGGGTCTGCAGGGCTCGGGG + Intronic
1160561861 18:79763987-79764009 TTCTGGCTCTGCAGCTCCGAGGG - Intergenic
1160739764 19:680378-680400 CTGCAGGTCTGCGGCTCAGACGG + Exonic
1160816731 19:1039474-1039496 GTGTGGGTCCACAGCTTTGAAGG - Intergenic
1161383117 19:3976984-3977006 CTCTGGGCCTGGAGCTCTGAAGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162901420 19:13797127-13797149 CTGTGGGTCAAGAACTCTGAGGG - Intronic
1163222476 19:15931425-15931447 CTGTGTTACTGCACCTCTGAGGG - Intronic
1163520389 19:17788261-17788283 CTGTGGGGGTGCAGCTGTGAGGG - Exonic
1163674577 19:18649024-18649046 CTGAGCTTCCGCAGCTCTGACGG + Intronic
1163685853 19:18711269-18711291 CTCTGGGTCAGCAGCTGTGTGGG - Intronic
1164776542 19:30857638-30857660 ATGTGGAACTGCAGCTCTGGGGG + Intergenic
1165464927 19:35968325-35968347 CTGTGGGTCTCCTGTCCTGAAGG + Intergenic
1165485074 19:36090539-36090561 CTGTCTGTCTGCTGCCCTGATGG + Intronic
1166120861 19:40685511-40685533 CTGTGAGTCTGAGGCCCTGAAGG + Intronic
1166254838 19:41596107-41596129 CTGTGGCTCTGCTGCCCTGGGGG - Intronic
1166619459 19:44283184-44283206 CTATGGGTCTGCGGCACTCATGG + Intronic
1167503009 19:49857856-49857878 TTGGGGGTCTCCAGCCCTGAGGG + Intronic
1168691403 19:58379731-58379753 CTGTTGCTCTGCAGTTCTGCAGG - Intronic
924985940 2:269930-269952 CTTTGGGTCTTCATTTCTGAAGG + Intronic
926419671 2:12684355-12684377 TTGTGGGTCTGCAGCCCCTATGG + Intergenic
926633568 2:15158633-15158655 GGCTGGGTCTGCAGCCCTGAGGG - Intergenic
926756501 2:16240590-16240612 ATGTGGGGCTGAAGCACTGATGG + Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
928251965 2:29688998-29689020 CAGTGATTCTCCAGCTCTGAAGG + Intronic
929695946 2:44115335-44115357 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
930105438 2:47635419-47635441 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
931547573 2:63406607-63406629 CTTTGGGTCTTCATTTCTGAAGG - Intronic
932014573 2:68011412-68011434 CAGTTGGTCTGAAGTTCTGATGG - Intergenic
935787885 2:106565628-106565650 CTGTGGGTCTGCTGTTCTCTAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937501770 2:122487187-122487209 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
939259774 2:139792359-139792381 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
939497705 2:142943756-142943778 CTGAGGGTCTGCAGCTGTGGGGG - Intronic
939863019 2:147441755-147441777 CTGGGGGTCCTCAGCTCTGAAGG + Intergenic
941060311 2:160839951-160839973 CTGTGGGGCTGTAACTCTCAAGG - Intergenic
941809987 2:169745910-169745932 ATGTGGGTTTGCAGCTGAGAAGG + Intronic
941877265 2:170446840-170446862 CTTTGGGTCTTCATATCTGATGG - Intronic
941958977 2:171235205-171235227 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
942370685 2:175281012-175281034 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
946740738 2:222798739-222798761 CCAGGTGTCTGCAGCTCTGAAGG + Intergenic
947568790 2:231214489-231214511 CTGTGGGTCAGCAGGTCCAAAGG + Intronic
948055204 2:235005589-235005611 CGGGGGTTCAGCAGCTCTGAGGG - Intronic
948661567 2:239510113-239510135 CAGTGGGACTCCAGTTCTGAGGG + Intergenic
948825758 2:240572836-240572858 CTGGGGATCAGCAGCTCTGTCGG - Intronic
1170795025 20:19539732-19539754 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1173595702 20:44257518-44257540 CTGTGGCTCTGGGGCTCTGGGGG - Intronic
1173600044 20:44288263-44288285 CTATGGCTCTGCTGCTATGATGG + Intergenic
1173745900 20:45436934-45436956 CTTTCGGTTTGCAGCTCTCAGGG + Intergenic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1174901261 20:54503677-54503699 CTGTGGTTCTTCTTCTCTGAAGG - Intronic
1175220576 20:57414346-57414368 CTGGGGGTCTGCACCCCTGAAGG - Intergenic
1175933639 20:62505166-62505188 CTGTGGTTCTTGAGCTCTGGAGG - Intergenic
1176139195 20:63537728-63537750 CTGTGCCCCCGCAGCTCTGAGGG - Intergenic
1176998898 21:15587776-15587798 CGGTGGGTCTTCATTTCTGAAGG + Intergenic
1177299643 21:19226359-19226381 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1178577991 21:33812451-33812473 CTGTGTGACTGCAGATCTAAAGG - Intronic
1178676472 21:34635533-34635555 CTTTGGGTGGGCAACTCTGAGGG - Intergenic
1178996473 21:37405237-37405259 CTGTGGGTCCCAAGCTCTGCAGG + Intronic
1179188787 21:39106337-39106359 CTGTGGTTGTGCAGCTCACATGG + Intergenic
1179462250 21:41544434-41544456 CTGTGGGTCTTTATTTCTGAAGG + Intergenic
1179626221 21:42650976-42650998 CTATTGGTCTGCTTCTCTGAAGG + Intergenic
1179649035 21:42794704-42794726 CTGCAGGTTTGCAGCTCAGAGGG - Intergenic
1179797736 21:43795030-43795052 CTGTCTGTCAGCAGCTCTGGGGG + Intronic
1182912856 22:34001923-34001945 CTGAGGGTGTCCAGCTCTGCAGG - Intergenic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1183755228 22:39755699-39755721 CTGAGGTTCTGCAGTTCTAAAGG + Intronic
1184328102 22:43806932-43806954 CTGTGGGGCTGCAGATGTGGTGG + Intronic
1184768927 22:46586835-46586857 CTGAGGCCCTGCAGCTCTGAGGG + Intronic
1184946783 22:47809383-47809405 CTGCGGGTCTGCAGCTCCCCAGG + Intergenic
1185246866 22:49777293-49777315 CTGTGGGTGCGCAGGTCTGGAGG + Intronic
1185311577 22:50158656-50158678 CAGTGGCTCTGGAGCTCTGGTGG + Intronic
949575931 3:5339256-5339278 CTGCGAGGCTGCAGTTCTGATGG - Intergenic
949689549 3:6620222-6620244 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
949690508 3:6631672-6631694 GTTTGGGTCTGCATTTCTGAAGG + Intergenic
950805710 3:15601552-15601574 CTCTGGTACTGCACCTCTGACGG + Exonic
951671381 3:25186850-25186872 CTTTGGGTCTTCATTTCTGAAGG - Intronic
952001835 3:28794796-28794818 CTGTGGGCCTGAAGCTCTCCAGG + Intergenic
952173030 3:30830320-30830342 CTTTGGATCTTCATCTCTGAAGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954750946 3:52813412-52813434 CTGTGGAGCTGTAGTTCTGATGG - Exonic
955408940 3:58643468-58643490 CTGCGGTTCTACAGCTCTGCGGG + Intronic
955842432 3:63126488-63126510 GTCTGGGGCTGCAGCTGTGAAGG + Intergenic
956181172 3:66519326-66519348 CTGTTGGTCTGCTGGTCTGCAGG + Intergenic
956323622 3:68026524-68026546 GTGTGGGTCTGCAGTGCTTAGGG - Intronic
957012881 3:75028169-75028191 CTGTGGCTTTGCAGCTTTGCAGG + Intergenic
957114563 3:76008853-76008875 CTTTGGGTCTTCATTTCTGAAGG - Intronic
957315774 3:78574902-78574924 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
957412653 3:79861021-79861043 GTGTGGCTCTGCAAGTCTGAAGG - Intergenic
957591508 3:82205209-82205231 CTGTGGGTTTCCAGGTTTGAAGG + Intergenic
958889722 3:99770029-99770051 CTTTGGGTCTTCATTTCTGAAGG - Intronic
960375293 3:116893129-116893151 TTGTGTGCCTGCAGCTCTAATGG + Intronic
960507954 3:118515764-118515786 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
961391195 3:126553201-126553223 CTGTGGGGCTGCAGCTGGGAGGG - Intronic
961489773 3:127246773-127246795 CTGTGGGCCTGAAGCCCTCATGG - Intergenic
962622041 3:137189896-137189918 CTGAGAGTCTTCAGCTCAGAGGG - Intergenic
963274173 3:143313969-143313991 CTGTGGGACTGCGGATGTGAGGG + Intronic
963298704 3:143575785-143575807 CTCTGGGTCTGCAGAGCTCAGGG + Intronic
963827189 3:149969368-149969390 CTATGACTCTGCAGTTCTGATGG - Intronic
964528087 3:157636956-157636978 CTTTGGGTCTTCATTTCTGAAGG - Intronic
968510535 4:993611-993633 CTGTGGCTCTGCGGCCCTGCCGG + Intronic
969494598 4:7519361-7519383 CTGTGGGCTTCCAGCTCTGTGGG - Intronic
969723482 4:8906186-8906208 TTGGGGGGCTGCAGCTGTGAGGG - Intergenic
971480976 4:27114696-27114718 CTGAGGGCCTGGAGCTCTGGGGG + Intergenic
971628832 4:28961809-28961831 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
973932120 4:55803607-55803629 CTCTGGGTGTCCAGCTATGAAGG + Intergenic
974812595 4:66964473-66964495 CTTTGGGTCTTCATTTCTGAGGG - Intergenic
974845366 4:67345395-67345417 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
975672453 4:76795230-76795252 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
977202247 4:94130823-94130845 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
977396077 4:96472509-96472531 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
978808540 4:112825710-112825732 CTTTGGGTCTTCATTTCTGAAGG - Intronic
980001474 4:127494233-127494255 CTTTGGGACTGCATTTCTGAAGG - Intergenic
980532859 4:134076724-134076746 ATGTGGGTCTGGAGCTTTGAGGG + Intergenic
982654645 4:158132296-158132318 CTGTGTTTCTGCAGCTCCCATGG + Intronic
982774392 4:159427263-159427285 CTGGGGGTCTTCAGGTGTGATGG - Intergenic
983956167 4:173701248-173701270 CTGACGGTATGCAGCCCTGATGG - Intergenic
985138357 4:186812335-186812357 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
985558100 5:568012-568034 CTGAGGGGCTGCCTCTCTGAGGG + Intergenic
987835574 5:23156616-23156638 CTGTGGGTCTTCATTTCTGAAGG + Intergenic
988611832 5:32734242-32734264 CTGTGGCTCTTCAGCTCTGGTGG - Intronic
988716148 5:33830110-33830132 CTGTGGGCATGAGGCTCTGATGG + Intronic
990406342 5:55494750-55494772 GTGTGTGTCAGCAACTCTGAGGG + Intronic
992211770 5:74487005-74487027 CTCTGGGTCTTCATTTCTGAAGG + Intergenic
993033127 5:82727561-82727583 CTTTGGGTCTCCATTTCTGAAGG - Intergenic
993581416 5:89666252-89666274 CTGAGACTCTGCAGTTCTGATGG + Intergenic
994505516 5:100638933-100638955 CTATGGGTCTTCATTTCTGAAGG + Intergenic
995752897 5:115472180-115472202 CTGTGGGACTGCACTTCTCATGG + Intergenic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
998536045 5:142931825-142931847 CTGTGTTTCTGCCTCTCTGAGGG + Intronic
998805576 5:145915091-145915113 CTGTGGGACAGCAGATCTCAAGG - Intergenic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999539698 5:152557958-152557980 CTTTGGCTCTGCAGCTCTCCTGG - Intergenic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
1000232626 5:159330373-159330395 CTGTGGGCCTGCAGCTGTCCAGG - Intronic
1001083487 5:168683890-168683912 CTCTGGGCCTGCAACTCAGAAGG - Intronic
1002426010 5:179176371-179176393 ATGTGGGTCTGGAGCCCTGCGGG - Intronic
1002780449 6:361111-361133 CTTTGTATCCGCAGCTCTGAGGG - Intergenic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1004410327 6:15375576-15375598 CTGTGGGTCTCCAGCAGAGAGGG + Intronic
1004432039 6:15554172-15554194 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1005010329 6:21329549-21329571 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1005414256 6:25584551-25584573 CTTTGAGTCTGCATTTCTGAAGG - Intronic
1006151875 6:31994178-31994200 CTGTGGCCCTGAAGCTTTGATGG + Intronic
1006158176 6:32026916-32026938 CTGTGGCCCTGAAGCTTTGATGG + Intronic
1006628208 6:35412548-35412570 GTTTGGGTCTGCAGCTAAGATGG + Intronic
1006965494 6:37979992-37980014 CTGTGCAGCTGCAGCTCCGAAGG - Intronic
1007228520 6:40331569-40331591 CAGTGCTTCTGCAGCTCTGCAGG + Intergenic
1007507069 6:42343926-42343948 CTGAGGCTCAGCAGCTCTGCTGG - Intronic
1007790849 6:44307276-44307298 CTCAGTGTCTGCATCTCTGATGG - Exonic
1008583746 6:52930147-52930169 CTTTGTGTCTGAAGCACTGATGG - Intergenic
1009027390 6:58016280-58016302 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
1009202927 6:60767763-60767785 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
1010767794 6:79796102-79796124 CCATGGGCCTACAGCTCTGAAGG - Intergenic
1011192117 6:84740078-84740100 CTCTGGGGGTGCAGCTCTGAGGG + Intronic
1012847941 6:104413284-104413306 CTCTGGGTCTTCAACTCTGAAGG + Intergenic
1013424426 6:109998211-109998233 CTGTGGGACTCCATCTCAGAGGG + Intergenic
1013728553 6:113133434-113133456 CTGTGAGTGTGCATCACTGATGG - Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1013975550 6:116074316-116074338 CTGAGGGTCTCCAGCTCTGCTGG + Intergenic
1014164604 6:118209218-118209240 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1014401895 6:121000143-121000165 CTTTGTGTCTGGAGCTCTCAGGG - Intergenic
1015265978 6:131292949-131292971 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1016449511 6:144166975-144166997 CTGTGGCCCTGCATCTCTGAGGG + Intronic
1016676167 6:146771233-146771255 CTCTGGGTCTTCAGCTGTGAAGG + Intronic
1017000333 6:149992027-149992049 CTGTGGCTTTGCAGCTGTCATGG + Intergenic
1017969913 6:159303394-159303416 AGTTGGGTCTGCAGCTGTGAAGG + Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018291639 6:162298058-162298080 CTGTGGGTGTCAACCTCTGAGGG - Intronic
1018341778 6:162858614-162858636 CTTTGGGTCTCCATTTCTGAAGG - Intronic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1020257394 7:6509703-6509725 CAGTTGCTCTGCAGCTCAGAAGG - Intronic
1021901138 7:25287004-25287026 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1022511638 7:30938570-30938592 CTGTGGCTCTGCAGGGCTGCAGG - Intergenic
1022550899 7:31237924-31237946 CTGTGGGCCTGCAGCTAGGGTGG + Intergenic
1023935570 7:44737558-44737580 CTGTGGGCCAGCAGCTCTCATGG - Intergenic
1024588162 7:50858804-50858826 CTGTGGTTCAGCAGCTCTTCTGG - Intergenic
1026343204 7:69451897-69451919 TTCTGGGTCAGCAGCTGTGAGGG - Intergenic
1026403144 7:70036684-70036706 CTGTGGGTCTGTGGCTCTGGAGG + Intronic
1026481867 7:70786232-70786254 CTGTGGCTATCCAGTTCTGAGGG + Intronic
1027145314 7:75689937-75689959 CTCCCGGTCTGCAGCCCTGATGG + Intronic
1027596384 7:80179406-80179428 CAGTGGTTCTGAAGCTATGATGG - Intronic
1028606073 7:92657034-92657056 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1030610021 7:111679319-111679341 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1031485810 7:122322309-122322331 TTGTGGATCTGCAGTCCTGAAGG + Intronic
1031515405 7:122692618-122692640 GAGTGGGTCTTCAGTTCTGAGGG - Intronic
1031896005 7:127348137-127348159 CCGTGGGTCTGCAGCTCTTGCGG - Intronic
1031992908 7:128209506-128209528 CTGTGGCTCTGCAGCAGTAAAGG - Intergenic
1033138980 7:138808374-138808396 CTGTGGCTCTGCACAGCTGAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034717463 7:153256729-153256751 TGGTGGGGCTGCAGCCCTGAAGG + Intergenic
1035885184 8:3283858-3283880 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1036505440 8:9350614-9350636 CTGTGTGTGGGCAGCTCTGCTGG - Intergenic
1038325803 8:26571868-26571890 CTTTGTGTGTGTAGCTCTGAAGG - Intronic
1039303813 8:36239189-36239211 CTTTGGCTCTTCATCTCTGAAGG + Intergenic
1040680495 8:49802571-49802593 CCATGGGTCTTCATCTCTGAAGG + Intergenic
1040912810 8:52538175-52538197 CTGGGGCTCTGCAGCACTGTAGG + Intronic
1042857552 8:73283428-73283450 CTGTGGTTCTGTAGCTCTTGAGG - Intergenic
1044726769 8:95200719-95200741 CTGTGGGGCTGCAGCTGCAATGG + Intergenic
1044954720 8:97468088-97468110 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1045267389 8:100631275-100631297 TTGTGGGTTTGCAGTTCTCATGG - Intronic
1046138481 8:110061162-110061184 CTGTGGGGCCGCAGCTGTGGCGG - Intergenic
1046958771 8:120087755-120087777 CTTTGGGTCTTCATTTCTGAGGG + Intronic
1048929156 8:139297190-139297212 CTGCAGCTCTGCAGCTCAGAGGG + Intergenic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1050043056 9:1515544-1515566 CTGTGGGAAAACAGCTCTGAGGG + Intergenic
1051743508 9:20273871-20273893 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1052584654 9:30411265-30411287 CTGTGGGCCGGCAGCTTTCAGGG - Intergenic
1053173484 9:35906829-35906851 CACTGGGTCTGCAGTGCTGAAGG + Exonic
1055020069 9:71660137-71660159 CTGTCTGTCTCCAGCTTTGAGGG - Intergenic
1055080597 9:72264788-72264810 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1056586319 9:87929770-87929792 CTGTGGCTTTGCTGCTCTCATGG - Intergenic
1056610563 9:88123173-88123195 CTGTGGCTTTGCTGCTCTCATGG + Intergenic
1056775988 9:89512874-89512896 TTGTGGTTCTGCATCCCTGATGG + Intergenic
1056843781 9:90019703-90019725 CTGTGATGCTGCAGCTCTGGGGG - Intergenic
1057228617 9:93305449-93305471 CTCTGGGTGAGCAGCTCCGAAGG - Intronic
1057485172 9:95477267-95477289 TTGTGGCTCTTCAGCTCTGGTGG - Intronic
1059415136 9:114157504-114157526 CTGAGGGTCCGCAGCGCTGGTGG - Intronic
1060934513 9:127507423-127507445 CTGTGGCCCTGTAGCTGTGAAGG - Exonic
1061039019 9:128128877-128128899 CTGGGGACCTGCAGCTCTCACGG - Intergenic
1061052611 9:128205141-128205163 CTGTGTCTCTGCAGCTCCGGGGG - Intronic
1061940088 9:133879135-133879157 CTGCGAGTCTGCAGCTGAGACGG - Intronic
1062137484 9:134937370-134937392 CTGTGGGCCACCAGCTCTGCAGG - Intergenic
1062268320 9:135697444-135697466 CTTTGGGTCTGCTGCTCCCAGGG + Intronic
1062482544 9:136759263-136759285 CTATGGGTCTGCAGTGCTGTGGG - Intergenic
1185789602 X:2918806-2918828 CTGTGTGTCTCCTACTCTGAGGG - Intronic
1187933207 X:24312344-24312366 CTGTGGGTCAGCAGCTGTGACGG + Intergenic
1187939017 X:24363710-24363732 CTGTGGGTCAGCAGCTGTGACGG - Intergenic
1189861106 X:45273470-45273492 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1189958639 X:46303958-46303980 GTGTGTGTCTGCAGCTGTGTTGG - Intergenic
1194812945 X:98407917-98407939 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1195289999 X:103423465-103423487 CTGTGGGTCTGCAGTGGTGGTGG - Intergenic
1196384874 X:115138417-115138439 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1197719537 X:129735756-129735778 CTGAGGTTCTGCAGTTCTGCAGG - Intergenic
1198185996 X:134254653-134254675 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
1199020084 X:142868740-142868762 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1199559904 X:149151292-149151314 TTGTGGGTCTTCAGGTTTGAGGG - Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic