ID: 1122782844

View in Genome Browser
Species Human (GRCh38)
Location 14:104150872-104150894
Sequence CTGGGCTGGTGCTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 430}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122782831_1122782844 28 Left 1122782831 14:104150821-104150843 CCCTGTCGGGTGGTGTTCGGAAA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG 0: 1
1: 1
2: 6
3: 59
4: 430
1122782830_1122782844 29 Left 1122782830 14:104150820-104150842 CCCCTGTCGGGTGGTGTTCGGAA 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG 0: 1
1: 1
2: 6
3: 59
4: 430
1122782836_1122782844 3 Left 1122782836 14:104150846-104150868 CCTAGGTGGTCACAGCCACAGCA 0: 1
1: 0
2: 3
3: 31
4: 273
Right 1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG 0: 1
1: 1
2: 6
3: 59
4: 430
1122782835_1122782844 4 Left 1122782835 14:104150845-104150867 CCCTAGGTGGTCACAGCCACAGC 0: 1
1: 0
2: 3
3: 14
4: 180
Right 1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG 0: 1
1: 1
2: 6
3: 59
4: 430
1122782832_1122782844 27 Left 1122782832 14:104150822-104150844 CCTGTCGGGTGGTGTTCGGAAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG 0: 1
1: 1
2: 6
3: 59
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122782844 Original CRISPR CTGGGCTGGTGCTGTCCTGG GGG Intronic