ID: 1122782908

View in Genome Browser
Species Human (GRCh38)
Location 14:104151111-104151133
Sequence CAGAGCAAAGCTCACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122782908_1122782914 14 Left 1122782908 14:104151111-104151133 CCCTCCCAGTGAGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 26
4: 258
Right 1122782914 14:104151148-104151170 CTTGCTCCTCCTCCTCTTCCTGG 0: 2
1: 0
2: 15
3: 162
4: 1019

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122782908 Original CRISPR CAGAGCAAAGCTCACTGGGA GGG (reversed) Intronic
901881494 1:12196666-12196688 CAGGGCAAAGAGCACTGAGATGG - Intronic
904870949 1:33617824-33617846 CAGACCAAAGCTCCTTGAGAAGG + Intronic
905856987 1:41320774-41320796 CTGAGCAAATGTCTCTGGGAAGG + Intergenic
906199261 1:43948580-43948602 TAGAGCTAAGCTTACTTGGATGG + Intronic
906771842 1:48492134-48492156 GAGAACACAGCTCACTGGGATGG + Intergenic
907393984 1:54177041-54177063 CAGGCCACAGCTCACGGGGAGGG + Intronic
907488780 1:54795437-54795459 CAGAGCAAAGCTGACTCACAAGG - Intronic
908281881 1:62548298-62548320 CAGAGTCAACCTCACTGAGAAGG + Intronic
908575874 1:65459435-65459457 GCCAGCAAAGCTCACTGGGGAGG + Intronic
910369329 1:86499141-86499163 CAGAGCAGAGCTCTTTTGGAAGG + Intronic
911126121 1:94342586-94342608 CAGAGGCAACCTCACAGGGAAGG - Intergenic
911314849 1:96343460-96343482 CACAGAAAAGCTCTCAGGGAGGG + Intergenic
913266616 1:117051424-117051446 CAGGGCAAGTCTCACTGAGATGG + Intergenic
913498282 1:119448094-119448116 CAGGGCAATTTTCACTGGGAAGG + Intergenic
914855110 1:151345041-151345063 TAGAGAAAGGTTCACTGGGAAGG - Intronic
914859130 1:151372167-151372189 CACAGCAAAGCTCTCTGGGAGGG - Intronic
915492597 1:156259425-156259447 AAGAGCAAAGGACACTGGGCTGG + Intronic
916678331 1:167082861-167082883 CAGTCCAAAGGTCACTGGGTAGG + Intronic
918456506 1:184724081-184724103 CAGAGGAAGGCTCACTTTGATGG + Intronic
919273118 1:195376722-195376744 CAGAGCCAAGTGCACTGGGATGG + Intergenic
919666086 1:200293980-200294002 CAGAGCAGAACTCACGGGGTTGG + Intergenic
919734455 1:200937025-200937047 CAGAGCAGAGTGCAGTGGGACGG + Intergenic
919903108 1:202058387-202058409 CTGAGCATAGGTCACTGGAAGGG + Intergenic
923676560 1:236085511-236085533 CAGAGAAAACCTCACTGAGAAGG + Intergenic
924684363 1:246272905-246272927 CAGAGAAAAGCTGACTTGGAGGG - Intronic
1063424954 10:5943626-5943648 CAGAGCAAGGCTCTCAGGGGCGG + Intronic
1063525782 10:6783645-6783667 CACAGCAGAGAGCACTGGGAAGG - Intergenic
1064806190 10:19136654-19136676 CAGAGCAAAGCTTTCTGGATTGG - Exonic
1065626740 10:27637698-27637720 CAGAGGAAAGATGACTGAGATGG + Intergenic
1067306469 10:45069326-45069348 AGGAGCAAAGGTCACTGGAAAGG + Intergenic
1070186963 10:74073675-74073697 CAGAGCACTACTCAATGGGAAGG - Intronic
1071260698 10:83916388-83916410 CATCCCAAAGCTCACTGGGCAGG - Intergenic
1071703695 10:87972826-87972848 CAGAACAGGCCTCACTGGGAAGG + Intergenic
1072072866 10:91936854-91936876 AAGACCAGAACTCACTGGGAAGG - Intronic
1072786301 10:98285357-98285379 CAGAGCCAAGCTCCCTCTGAAGG - Intergenic
1073502385 10:103952137-103952159 CAAAGGAAAGCTCTCTGGAAGGG + Intergenic
1073897466 10:108179707-108179729 CAGAGAAAAGGGCACTGAGAGGG - Intergenic
1074401539 10:113144925-113144947 CAGAGTACAGATCACTGGTAAGG - Intronic
1076441439 10:130483804-130483826 CAGACCTCAGCTCACTGGGCTGG - Intergenic
1077539588 11:3140264-3140286 CACAGCAATGCTCTCTGTGAAGG + Intronic
1078532505 11:12148067-12148089 CTGAGAAAAGCTCCCTGAGAAGG - Intronic
1078740822 11:14064752-14064774 CAGAGCATAGGTAAATGGGATGG + Intronic
1078903566 11:15663857-15663879 CACAACAAAGCACAGTGGGAGGG + Intergenic
1081332516 11:41821909-41821931 CAGTGCAAAGCTGAGTGGAATGG - Intergenic
1081705370 11:45179899-45179921 CTGAGGAACTCTCACTGGGATGG - Intronic
1083665177 11:64270198-64270220 TGGAGCGAAGGTCACTGGGAGGG + Exonic
1083881120 11:65548736-65548758 CAGAGCAGAGTTCACTGTTATGG - Intronic
1084348945 11:68580075-68580097 CAAGGAAAATCTCACTGGGAAGG + Intronic
1089581756 11:119485698-119485720 TAGAGCAGTGCGCACTGGGAAGG + Intergenic
1089588679 11:119526063-119526085 CAGAGAAGACCTCACTGAGAAGG - Intergenic
1094284159 12:28773665-28773687 CTGTGCAAAGCTCTCTGGCAAGG + Intergenic
1096973201 12:55683804-55683826 AAGAGCACACCTCCCTGGGAGGG - Exonic
1098357347 12:69624185-69624207 CAGACCAAAGCGCCCTGGGGAGG + Intergenic
1098511018 12:71314242-71314264 CAGACCAAAGAACAGTGGGAAGG - Intronic
1098911872 12:76217283-76217305 CAGAGGAAGCCTCACTGAGAAGG - Intergenic
1100234128 12:92640971-92640993 CAGAGCAGTGGTCACAGGGAGGG + Intergenic
1104400986 12:128475984-128476006 CAGAGCAAAAGTCACTGGTAGGG - Intronic
1105433047 13:20354787-20354809 CAGGGCAGGCCTCACTGGGAAGG - Intergenic
1105503298 13:20990233-20990255 TAGAGCACAGCTCAAAGGGAAGG - Intronic
1105781419 13:23707988-23708010 CAGCGGTGAGCTCACTGGGAAGG - Intergenic
1106462300 13:29981734-29981756 CAGAGCTCAGGTCCCTGGGAGGG - Intergenic
1108531620 13:51332016-51332038 CATGGCCAAGCTCACTGGGAAGG + Intergenic
1110116712 13:71826546-71826568 CAAAACAAACCTCAGTGGGATGG - Intronic
1113649325 13:112024568-112024590 CATAGCACAGCACACTGGGGTGG - Intergenic
1113741763 13:112716292-112716314 CGGAGCAGAGCTCACCAGGAGGG - Intronic
1115081172 14:29452125-29452147 CTGAGCACAGCCAACTGGGATGG + Intergenic
1115465926 14:33714044-33714066 CAGAGAAGACCTCACTGAGAAGG - Intronic
1116179111 14:41513345-41513367 CAGGGCAAAGTCCAGTGGGAAGG - Intergenic
1117556253 14:56888003-56888025 GAGAGCAAGGCACACTGGGGTGG + Intergenic
1118452638 14:65917999-65918021 CCCAGCATAGCCCACTGGGAGGG + Intergenic
1118608046 14:67517312-67517334 CAGAGGAAAGCACAATGGGCTGG + Intronic
1118673198 14:68153335-68153357 CAAAGGAAAGATCACTGGAAAGG - Intronic
1119003668 14:70905770-70905792 GACAGGAAAGCTCTCTGGGAAGG - Intergenic
1119007640 14:70946005-70946027 TGGAGAACAGCTCACTGGGAAGG - Intronic
1119749892 14:77069759-77069781 GAGGGCAAAGCGCTCTGGGACGG + Intergenic
1119769312 14:77210608-77210630 GAGAGTAAACCTCACTGAGAGGG + Intronic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1122035707 14:98947885-98947907 CAGAACAAATCTCATGGGGATGG - Intergenic
1122762870 14:104042766-104042788 CAGAGCCAGTCTCCCTGGGAAGG + Intronic
1122782908 14:104151111-104151133 CAGAGCAAAGCTCACTGGGAGGG - Intronic
1123035024 14:105468483-105468505 CAGAGCTAAGCAAACTGGCAGGG + Intronic
1123954022 15:25314872-25314894 CAGAGCAAAGATCATTAGCAAGG - Intergenic
1124589021 15:31036844-31036866 CAGAGCAAAGCTCTGTGTGGGGG - Intronic
1126234318 15:46364750-46364772 CAGAGCACATCTCACTGGACTGG - Intergenic
1126574491 15:50183685-50183707 CAGAGACAAGCTCTCTGGGAGGG - Intronic
1126689028 15:51273546-51273568 CAGAGGAAAGAGCACTGGAATGG + Intronic
1127539956 15:59927605-59927627 CAGTGGAAAGCTCACTGGCTTGG - Intergenic
1127546563 15:59998777-59998799 CAGAGCAAAACTTATGGGGAGGG + Intergenic
1129614040 15:77083974-77083996 CTGAGCAAAGCCGACTGGGTAGG - Intronic
1132065090 15:98724503-98724525 CAGAGAAAAGCTGACGGTGATGG - Intronic
1132860845 16:2071060-2071082 CTGAGCAGAGGTGACTGGGATGG + Intronic
1132947546 16:2540204-2540226 CAAGGGAAAGTTCACTGGGAAGG - Intronic
1132968195 16:2671419-2671441 CAAGGGAAAGTTCACTGGGAAGG + Intergenic
1133020319 16:2964186-2964208 GAGAGCTAGGCTCAGTGGGAGGG + Exonic
1136513052 16:30750897-30750919 CAACACAAAGCTCACAGGGAAGG - Intronic
1137577043 16:49606898-49606920 CAGAGCAGAGCCCACCGGGTGGG + Intronic
1139006563 16:62578564-62578586 CAGCGCAAAGTTCACTGATACGG + Intergenic
1139932274 16:70537735-70537757 CAGAGCAGAGCTTACTCGGTGGG + Intronic
1142235560 16:88920899-88920921 CAGGGCCAAACTCACTGGGGAGG + Intronic
1143416845 17:6756658-6756680 TGGAGCAAAGCTCTCTGGGGAGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143776135 17:9200122-9200144 CTGAGCAGGGCTCCCTGGGAAGG - Intronic
1143901493 17:10177980-10178002 GAGAGCAAAGCTGACAGGCAGGG + Intronic
1147262057 17:39214491-39214513 CACCCCAAAGCGCACTGGGACGG + Intronic
1148825763 17:50392745-50392767 CTGAGCAAAGCTGACAGGCAAGG + Exonic
1149580686 17:57748550-57748572 CAGAGTAAACCTGAATGGGATGG + Intergenic
1149696573 17:58621029-58621051 CAGAGGAAAGCCAAATGGGAAGG + Intronic
1151682049 17:75627444-75627466 GAGAGCGAAGCTGACTGGCATGG - Exonic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152661951 17:81546621-81546643 CTGAGCAGAGCTCGCTGGGCTGG + Intronic
1153773540 18:8433836-8433858 CCGAGCAGAGCTAACTGTGAAGG + Intergenic
1153953238 18:10074641-10074663 CAGTGCAAACATCACTGGGGTGG + Intergenic
1154032823 18:10767972-10767994 CAGGGCAAGGCCCCCTGGGATGG - Intronic
1155908072 18:31476325-31476347 CATAGCAAAGCTCACTGTATTGG + Exonic
1156346419 18:36260837-36260859 CAGAGAGAAGGTCACTGTGACGG - Intronic
1157194340 18:45608507-45608529 ATGAGCAAAACGCACTGGGACGG - Intronic
1157344434 18:46811937-46811959 CAGAGCAAATCTCCATGGAAAGG + Exonic
1159722109 18:71903918-71903940 CAGAGCAAAGCTAAATGGAAAGG - Intergenic
1162068881 19:8142000-8142022 CAGGGCAAAGTTCACATGGAAGG + Exonic
1162111800 19:8403661-8403683 CCGTGCAGAGCTCACTGGGAGGG - Exonic
1163249565 19:16118448-16118470 CAGAGGACAGCTCTCTGGGCTGG - Intronic
1163256336 19:16158067-16158089 CAGAGCAAGGCCCTCAGGGAGGG + Exonic
1163469884 19:17489883-17489905 AATAGCAAGGCTGACTGGGAAGG + Intronic
1164443561 19:28298633-28298655 CAGAGCAGAGAACACAGGGAAGG + Intergenic
1164717205 19:30401454-30401476 CAGAGCAAACCCCACTGGGGTGG - Intronic
1165443602 19:35844596-35844618 CAGAGCTAAGCTCAGGGGTAAGG + Intronic
1168048292 19:53809851-53809873 CAAAGCAAAGCTCAGAGCGACGG - Exonic
926235623 2:11041239-11041261 CAGAGCAGAGCAGAGTGGGAAGG - Intergenic
928182532 2:29079618-29079640 CAGAACACAGCACACAGGGAAGG + Intergenic
929297530 2:40265465-40265487 CTGAGCAAAGGTCAATGGAAAGG + Intronic
929297902 2:40269440-40269462 CTGAGCAAAGGTCAATGGAAAGG + Intronic
932583436 2:73007476-73007498 CAGACCTAACCTCACTGTGAGGG - Intronic
932714478 2:74091405-74091427 CAGTGCCTAGATCACTGGGATGG - Intronic
933143064 2:78817350-78817372 CAAAGCAAAGCTGTCTGGGAAGG + Intergenic
933598822 2:84309011-84309033 CAGGGCCATGCTCCCTGGGAAGG - Intergenic
934517507 2:94998142-94998164 CAGAGCAAGGCTCTTTGGAAGGG + Intergenic
935193677 2:100798207-100798229 CAGGGCCAAGCTCCCTGTGAGGG - Intergenic
936252075 2:110874710-110874732 CAGAGCAGAGCTCACGGTGGAGG + Intronic
937769084 2:125697434-125697456 CAGAGCAAAGCTCTGAGGAATGG - Intergenic
939700406 2:145384671-145384693 CAGAGACAACCTCACTGGTAAGG - Intergenic
940045050 2:149401066-149401088 CAGTGCAAAGCTTTCTTGGAAGG + Intronic
941873450 2:170409349-170409371 AAGAGGAAAGCTCTTTGGGAGGG - Intronic
942062989 2:172245045-172245067 CAGAGCAAACCTCAGTGTGCTGG + Intergenic
942481122 2:176389256-176389278 CAAAGGAAAACTCACTGAGAAGG - Intergenic
942525976 2:176853433-176853455 CAGAGCAAAGCCTATTGGGTAGG + Intergenic
944332866 2:198492778-198492800 CAGAGTAAACCTCATTGAGAAGG - Intronic
944374353 2:199024260-199024282 CCAAGAAAAGCTCACTGGAAAGG + Intergenic
944972003 2:205003553-205003575 CAGAACAGAGCTTACTGAGAAGG - Intronic
946679044 2:222194264-222194286 CAGAGGAAACCTCAAAGGGAGGG - Intergenic
947752129 2:232538707-232538729 CAGAGAGAAGCTCAGTGGGGGGG + Intergenic
948502431 2:238405318-238405340 GGGAGCAAAGCTCAGTGGGGCGG - Intergenic
948535564 2:238643927-238643949 CAGAGCAAACCCCACAGAGAAGG - Intergenic
1170311232 20:14994509-14994531 CAGAGCAGAGCTGACTGGAGAGG + Intronic
1170585391 20:17730454-17730476 CAGAGCAAGCCTCGCTGGTAAGG - Intronic
1170844948 20:19954483-19954505 CAGAGCGAAGCTGCCTTGGATGG + Intronic
1171093000 20:22303807-22303829 CAGGAAAAATCTCACTGGGAAGG - Intergenic
1172163844 20:32886749-32886771 CAGAGGAAGGCTCTCTGGGAAGG + Intronic
1172449785 20:35013856-35013878 CAGAGCCAGGCTCCCTGGGCTGG - Intronic
1172939409 20:38644303-38644325 CAGGGCAAAGCTCACGGTGGGGG - Intronic
1173039799 20:39451617-39451639 CAGAGCAGAGCTCACTGCAAAGG - Intergenic
1173400682 20:42723411-42723433 CACAGCCCAGCTCACCGGGAAGG - Intronic
1174197873 20:48786169-48786191 CTGAACAAAACTCCCTGGGAGGG + Intronic
1176182315 20:63756174-63756196 GAGCGGAAAGCGCACTGGGAGGG - Intronic
1178204232 21:30444360-30444382 CAGAAGAAAGCTGGCTGGGATGG - Intergenic
1178793298 21:35720478-35720500 CAGAGAAACGCTCACTTAGAAGG - Intronic
1179100345 21:38350899-38350921 GAGAGTTCAGCTCACTGGGAAGG + Intergenic
1179146205 21:38769917-38769939 CAGAGCAAAGCTCACTTAAAGGG - Intergenic
1179568316 21:42262887-42262909 CAGGCCAGAGCTCACTGGGGTGG - Intronic
1182611470 22:31551393-31551415 CAGGGGAAAGATCACTGGGCTGG - Intronic
1183256492 22:36765710-36765732 CAGAGCAAACCCCAGTGGAACGG + Intronic
1183953419 22:41365262-41365284 CAGAGCAAAGGGCACTGGCCAGG + Intergenic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184982437 22:48104009-48104031 CAGATCAAAGCTCACAGGGGAGG - Intergenic
950865456 3:16184905-16184927 CTGAGCACAGCTCACTGGGGTGG + Intronic
954748983 3:52803133-52803155 CAGAGCTGAGCCCACTGAGAGGG + Intronic
956955630 3:74335864-74335886 CAGAATAAACCTCACTGAGAAGG - Intronic
957278152 3:78115610-78115632 AAGAGCAAGGATCACTAGGAAGG + Intergenic
957964431 3:87304304-87304326 CAGAGACAAGCACACTTGGAAGG + Intergenic
958904386 3:99925840-99925862 GACAGCCAAGCTCACTGGGCTGG + Intronic
959312836 3:104762510-104762532 CTGAACAAAGCATACTGGGAAGG + Intergenic
961044981 3:123701909-123701931 CAGAGTCAAGGTCACTGGGCAGG - Intronic
961462760 3:127063116-127063138 CAGAGCAAAGACGGCTGGGAGGG - Intergenic
965006792 3:163037376-163037398 CTGAACAAAGCTCACTGGACAGG - Intergenic
967190965 3:186984630-186984652 CAGAGGAGAACTCACTGAGAAGG - Intronic
967449499 3:189607170-189607192 CAGAGCAGAGCCAACTGAGAAGG + Intergenic
968151218 3:196338171-196338193 CAGAGCCAGGCTCACTGGAGTGG + Intronic
970024702 4:11611088-11611110 CAGAACAAACCTCACTGTGATGG + Intergenic
970865621 4:20755709-20755731 CAGGGCAAGTCTCACTGAGAAGG + Intronic
971257264 4:25026306-25026328 AAGGGCAAAGCTCATTGCGAGGG + Intronic
972368413 4:38397371-38397393 CAGAGCCAACCTCACAGGGCTGG + Intergenic
975663558 4:76710861-76710883 AAGAGCAAACCTCACAGGGCTGG - Intronic
976636958 4:87295797-87295819 CAGAGAAATGCACTCTGGGAAGG - Intergenic
976929083 4:90541360-90541382 CAGAGAAAAGCTGACTTTGAAGG - Intronic
977121844 4:93112221-93112243 CAGAGAAAACCTCACTGAGCAGG + Intronic
977696477 4:99971701-99971723 CAGGGCAAAGCACACAGGGCAGG - Intergenic
982097741 4:151938108-151938130 CTGAGCAGAGCAGACTGGGAGGG + Intergenic
982182164 4:152758871-152758893 TAGAGCCAAGGTCACTGGGAGGG - Intronic
982306811 4:153941167-153941189 CAGAGCAAAGCAGCCTGTGAGGG - Intergenic
983335665 4:166388674-166388696 CAGAGAACAGTTCACTGGGAGGG - Intergenic
983891508 4:173034667-173034689 CAGGGAAAATCTCACTGAGAAGG - Intronic
984946498 4:184972678-184972700 CAGATCCAATCTCACTGGGCTGG + Intergenic
986254985 5:6094907-6094929 TAGAGGAAATCTCCCTGGGATGG + Intergenic
986284898 5:6351844-6351866 CAGACCAGAGTTCACTGGGCGGG + Intergenic
986370833 5:7078382-7078404 CAGAGCCCTGCTCACTGGAAGGG - Intergenic
988714462 5:33811412-33811434 CACAGCAAGTCTCACTGAGAAGG + Intronic
990410398 5:55535232-55535254 CAGAGCAAAGCCCCCTGGATCGG - Intergenic
992258989 5:74951129-74951151 CCCAGTAAAGCCCACTGGGATGG - Intergenic
994322039 5:98405378-98405400 CAGAGAGAGGCTCACTGGCAGGG + Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
998178201 5:139914970-139914992 AAGGCCAAGGCTCACTGGGAGGG - Intronic
999449353 5:151666613-151666635 CAGACCAAAGCTCACAGCGAGGG + Intronic
999585856 5:153088820-153088842 CAGAGCAAAGGGCACCAGGAAGG + Intergenic
1000090339 5:157924610-157924632 CTGAGCCAAGGTCAATGGGATGG + Intergenic
1000163978 5:158629291-158629313 CAGAGCACATGTCAGTGGGAGGG - Intergenic
1003266996 6:4574671-4574693 CAGAGAACAGCTGACAGGGAGGG - Intergenic
1003541700 6:7024069-7024091 CAGAGGAAAACACACTGGGCTGG - Intergenic
1004155725 6:13166183-13166205 CAGAGTAAGCTTCACTGGGAAGG - Intronic
1005415512 6:25596088-25596110 GAGAGAAAATCACACTGGGACGG - Intronic
1005768582 6:29040572-29040594 GAGAGCAAAGCTCTGTGGTAGGG + Intergenic
1006186986 6:32187070-32187092 CAGAACTAAGATCACTGGAATGG + Intronic
1007260326 6:40558973-40558995 CAGAGGAAGGCTAGCTGGGAAGG + Intronic
1007500915 6:42296129-42296151 CAGGGCACAGCTCAGCGGGAGGG + Intronic
1010449501 6:75987159-75987181 AAGAAAAAACCTCACTGGGAGGG + Intronic
1010764167 6:79759836-79759858 CAGAGAAAAGCTCTCTAGAAAGG + Intergenic
1012681250 6:102183963-102183985 CAGAGCAGATCTCACTGAGAAGG - Intergenic
1013274551 6:108571689-108571711 CAAAGCCATGCTCCCTGGGAAGG - Intronic
1014962708 6:127706735-127706757 CAGAGCAAGGCACATTGAGAAGG + Intergenic
1016186731 6:141206683-141206705 CAGAGTGAATGTCACTGGGAAGG - Intergenic
1016916631 6:149250056-149250078 CATAGCAAAACTCAATGAGAAGG + Intronic
1017713217 6:157188283-157188305 CAGTGCAGGGCTCACAGGGACGG + Intronic
1018266456 6:162029561-162029583 CAGAGCAAAGAGCGCTGGCATGG - Intronic
1019343246 7:518309-518331 CACAGCAAAGCTCCCGGGGATGG + Intronic
1019383046 7:737744-737766 CAGAGGAGACCTCACTGGGCAGG - Intronic
1020223496 7:6260735-6260757 CACAGCAAAGGGGACTGGGAGGG - Intronic
1020406973 7:7847501-7847523 CAGAGAAACGCTCACTGGGGAGG - Intronic
1021000418 7:15323683-15323705 CAGAGCAAAGGGCTATGGGATGG + Intronic
1022102759 7:27178589-27178611 CAGAGAGCAGCTCACTGGGTGGG + Intronic
1022473180 7:30694224-30694246 CAGAGCAAAGTTCAGAGAGAAGG - Intronic
1023165854 7:37343046-37343068 CAGAGCAGAACTCAGTGGTAAGG - Intronic
1023223263 7:37943107-37943129 CAAAGCATAGTTCACTGGGAGGG - Intronic
1023279346 7:38553771-38553793 CACAGCAAAGCCCTCTGGGCAGG + Intronic
1023834673 7:44061130-44061152 AAGAGCCAAGCTGTCTGGGAGGG - Exonic
1024459383 7:49644494-49644516 CAGAACAGAGCTGACTGTGAAGG + Intergenic
1026009036 7:66622452-66622474 CAGAGCAAAGCATTCAGGGAGGG - Intergenic
1028164997 7:87528613-87528635 CAGAGCACAGATCACAGGCAGGG + Intronic
1028543661 7:91973726-91973748 CAAAGAAAAGCTCAGTCGGATGG + Exonic
1028603069 7:92623809-92623831 CAGAGTAAAGCTCTATGGCAGGG - Intronic
1029262059 7:99309578-99309600 TAGGTCAGAGCTCACTGGGAGGG - Intergenic
1031334297 7:120507896-120507918 AAAAAAAAAGCTCACTGGGAGGG + Intronic
1031388782 7:121187257-121187279 CAGAGGACATCTCACTGCGAAGG + Intronic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1032185929 7:129726105-129726127 CAGAGCAAAGCTGACTCGACTGG + Intronic
1034765182 7:153713910-153713932 CAGAGTCAAGCTCACTGCAAGGG - Intergenic
1036637386 8:10560856-10560878 CTGAGCAAACCTCCCTGGCATGG + Intergenic
1036651256 8:10645645-10645667 AGGAGCAAAGCCCTCTGGGAAGG + Intronic
1039633291 8:39135659-39135681 CAGAGCAAAGGAGCCTGGGAGGG - Intronic
1044757253 8:95477079-95477101 AAGAGCAAAGATCACTGGGCTGG + Intergenic
1045438071 8:102184603-102184625 CAGAGCATAGCTCACAGCCATGG - Intergenic
1046792907 8:118340906-118340928 CAGAACAGAGCGCACTGGAAAGG + Intronic
1048491743 8:134900687-134900709 CAGAGCCACACTCCCTGGGAAGG + Intergenic
1049815916 8:144599964-144599986 CAGAGCAACTCTCTGTGGGAGGG + Intronic
1050488897 9:6166289-6166311 CAGATCAAAACTGACTTGGAAGG + Intergenic
1051686624 9:19664862-19664884 CAGAGCCATGCTCACTCTGAAGG - Intronic
1054792119 9:69266080-69266102 GATAGCAATGCTCAGTGGGACGG + Intergenic
1054860269 9:69945018-69945040 GAGAGCAAAGCCGAATGGGAAGG - Intergenic
1056083691 9:83123620-83123642 AAGAGCACGGCTCAGTGGGAAGG - Intergenic
1056097465 9:83270068-83270090 CAGAACAATGCTCACTGTGCAGG - Intronic
1056347746 9:85716471-85716493 CAGAGTAGAGCACACTTGGAAGG - Intronic
1056614022 9:88146711-88146733 CAGAGAAAAACTCATTTGGAAGG + Intergenic
1056940220 9:90949150-90949172 AAAAGCCAAGGTCACTGGGAAGG + Intergenic
1057114390 9:92506863-92506885 CAGAGAGAAGTACACTGGGAGGG + Intronic
1057384780 9:94597520-94597542 CAGAGTAAAACACACTGGAATGG - Intergenic
1058068464 9:100575855-100575877 CAGTACAAATCTCACTGGGTTGG - Intronic
1059125231 9:111678422-111678444 CAGAGCAAAGGTCAGTTGGCTGG - Intergenic
1059568533 9:115409053-115409075 CAGGGAAAACCTCACTGAGAAGG + Intergenic
1059865848 9:118513112-118513134 CAGAGGATAGATCACAGGGATGG + Intergenic
1062318391 9:135978935-135978957 CAGAGCCCAGCGCATTGGGATGG - Intergenic
1186803385 X:13115662-13115684 CAGAGCAGAACTCACCAGGAAGG + Intergenic
1186903095 X:14079218-14079240 CAGAGCCACGCTCCCTCGGAAGG - Intergenic
1190770579 X:53510775-53510797 CAGAAGAAACCTCACTGGGCTGG - Intergenic
1193513300 X:82432750-82432772 CCGAGCAAAGCCCACTGGCCTGG + Intergenic
1193572347 X:83160239-83160261 CAGAGAAAAGTTCACAGGAAAGG - Intergenic
1195468537 X:105208566-105208588 CAGAGAAAAGCTAAGTGAGAGGG + Intronic
1195480636 X:105340691-105340713 CAGGATAAACCTCACTGGGAAGG - Intronic
1198030213 X:132747349-132747371 CATAGGAAAGCTCGCTGGAAGGG + Intronic
1200836723 Y:7739612-7739634 CAGTGCAGAGCTCACGGGAAAGG + Intergenic