ID: 1122783360

View in Genome Browser
Species Human (GRCh38)
Location 14:104153093-104153115
Sequence CAATGTTGCCCCAGAGACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122783360_1122783367 21 Left 1122783360 14:104153093-104153115 CCGTAGTCTCTGGGGCAACATTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1122783367 14:104153137-104153159 CAGACCCTGCCCTTGCCTTCTGG 0: 1
1: 1
2: 6
3: 48
4: 378
1122783360_1122783368 22 Left 1122783360 14:104153093-104153115 CCGTAGTCTCTGGGGCAACATTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1122783368 14:104153138-104153160 AGACCCTGCCCTTGCCTTCTGGG 0: 1
1: 1
2: 3
3: 42
4: 437
1122783360_1122783371 29 Left 1122783360 14:104153093-104153115 CCGTAGTCTCTGGGGCAACATTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1122783371 14:104153145-104153167 GCCCTTGCCTTCTGGGCTTTCGG 0: 1
1: 0
2: 0
3: 24
4: 284
1122783360_1122783363 -2 Left 1122783360 14:104153093-104153115 CCGTAGTCTCTGGGGCAACATTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1122783363 14:104153114-104153136 TGGCCACTGATCCTAAGGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 106
1122783360_1122783362 -7 Left 1122783360 14:104153093-104153115 CCGTAGTCTCTGGGGCAACATTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1122783362 14:104153109-104153131 AACATTGGCCACTGATCCTAAGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122783360 Original CRISPR CAATGTTGCCCCAGAGACTA CGG (reversed) Intronic
900897800 1:5495970-5495992 CAAGGGTTCCCCAGAGACAAAGG - Intergenic
904257857 1:29267824-29267846 CAAAGGTGCCGCAGAGACCAGGG + Intronic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905631938 1:39523679-39523701 TAAGGTTGCCCCAGACACCAAGG - Intronic
905665822 1:39762513-39762535 TAAGGTTGCCCCAGATACCAAGG + Exonic
909356336 1:74714163-74714185 CTATGTTGCCCCAGACAGCACGG - Intronic
910601272 1:89034821-89034843 CAATTTTTCACCAGAGAATAAGG + Intergenic
915996183 1:160566495-160566517 CAGTTTTGCTCCAGATACTATGG + Intronic
918377453 1:183923398-183923420 AAGTGTTGCCCCACAGCCTAAGG - Intronic
920867868 1:209768326-209768348 CAATAGTGCCCCAGAGCCTATGG - Intronic
923598973 1:235384985-235385007 GAATGTTGTCCCAGAGATTCTGG + Intronic
1066644157 10:37588364-37588386 TAATGTTTCCCCAGAGATAAGGG - Intergenic
1070801277 10:79245700-79245722 GAATGTTGCCCCAGGGAGTAAGG + Intronic
1074468088 10:113701989-113702011 CAATATTGCCTCAGGGAATAGGG - Intronic
1075684872 10:124356794-124356816 CAATGTAGCCCCAGGAACTCTGG + Intergenic
1077952558 11:6976337-6976359 AAATGTTGACACAGAGACCAAGG + Intronic
1081063250 11:38505727-38505749 CACTGTTACCCCTGAGACTCAGG + Intergenic
1084631826 11:70357302-70357324 CAAAGATGCACCAGAGCCTATGG + Intronic
1090636013 11:128690998-128691020 CAAGCTGGGCCCAGAGACTAAGG + Intronic
1090637471 11:128699737-128699759 AGATGTTTCCCCAGAGGCTATGG + Intronic
1092147646 12:6225604-6225626 CCATGTTGACCCAGGGACTTGGG + Intronic
1096088720 12:48883866-48883888 TAATGGAGCCCCAGAGACGAGGG + Intergenic
1102436898 12:112931034-112931056 AAATGGTGACCCAGAGACTGTGG - Intronic
1104355978 12:128087546-128087568 GAATGTTGCACCAGAGAGAAAGG - Intergenic
1108380361 13:49848653-49848675 CCATGTGGCCCCAGCTACTAGGG + Intergenic
1108729381 13:53217844-53217866 CAATATGCCCCCAGTGACTAAGG + Intergenic
1109708855 13:66137600-66137622 GAATGTTGCCCTAGAGGCTAAGG + Intergenic
1109729367 13:66390772-66390794 CAACATTGCCTTAGAGACTATGG + Intronic
1113067724 13:106388879-106388901 CAATGTGGCCGCAGAGGCTGAGG - Intergenic
1113133466 13:107063108-107063130 CAATTTTGCTCCAAAGACAATGG + Intergenic
1115176820 14:30572318-30572340 CACTGTTGAATCAGAGACTAAGG + Intronic
1116403762 14:44542700-44542722 CCATGTTGCCGCAAATACTATGG - Intergenic
1116912942 14:50490705-50490727 CAAGGTGACCCCAGATACTAAGG - Intronic
1122783360 14:104153093-104153115 CAATGTTGCCCCAGAGACTACGG - Intronic
1124605952 15:31170522-31170544 CAGGGTAGGCCCAGAGACTAGGG + Intergenic
1125464490 15:39936806-39936828 CGATGCTGCCCCAGACACTGAGG - Intronic
1126672986 15:51133356-51133378 CCATGTTGTACCAGAGACTCTGG + Intergenic
1130058514 15:80551567-80551589 GACTGTTTCCCCAGAGTCTATGG + Intronic
1132038964 15:98508720-98508742 CAATGCTGCCCCAGTGCATAGGG + Intronic
1137587476 16:49672412-49672434 CCCTGCTGCCCCACAGACTATGG - Intronic
1140933121 16:79646423-79646445 CTATGTTGCCCCACAGCCTCAGG + Intergenic
1142288168 16:89179938-89179960 CAAAATCGCCCCAGAGACCAGGG + Intronic
1144726711 17:17505970-17505992 CAGTGTTGCCCCAGTGGCTCTGG - Intronic
1146548063 17:33756198-33756220 CAATGTCTCCCCAGAGCCTTTGG + Intronic
1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG + Intergenic
1155427855 18:25724793-25724815 CAATGTTGCCCCTGGGTCTCTGG - Intergenic
1157253935 18:46121037-46121059 CCTTTTTGCCCCAGAGATTAGGG + Intronic
1157855550 18:51101508-51101530 CAATGGTGCCCCAGGGCCGAGGG - Intergenic
1163389948 19:17024734-17024756 CAGTGTTGGCCCAGATGCTAGGG - Intronic
927359720 2:22218600-22218622 CAATGTTGCCCCAGATCTCAGGG - Intergenic
928255705 2:29720462-29720484 CAATCTTACCCCTGAGAGTAGGG + Intronic
930234840 2:48878618-48878640 CAAGGATGCCTCAGAGACCAGGG - Intergenic
930546986 2:52780731-52780753 CAATGTTGTGCTAGAGACTATGG - Intergenic
934474009 2:94580735-94580757 CAATGTTGACACAGAGAGAAGGG - Intergenic
941989172 2:171538331-171538353 CACTGTATCCCCAGAGCCTAAGG - Intronic
947104630 2:226655615-226655637 CCATGTGGCCCCAGAGTCTGTGG - Intergenic
947698687 2:232214766-232214788 CAATTTTCCCTCAGAGACTAAGG - Intronic
1176953150 21:15068649-15068671 CAGTGCTGCTCCAGAGGCTAAGG - Intergenic
1177002653 21:15633703-15633725 CAATGTTGGCAGAGAGACTTGGG - Intergenic
1180178835 21:46108686-46108708 CAGTGTTGCCACAAACACTAGGG - Intronic
1180307638 22:11142724-11142746 GGATGTTGCCCTAGAAACTACGG + Intergenic
1180307777 22:11143953-11143975 GGATGTTGCCCTAGAAACTACGG + Intergenic
1180546158 22:16504947-16504969 GGATGTTGCCCTAGAAACTACGG + Intergenic
1182018980 22:27065051-27065073 CAAAGCTGCCCCAGAGGCTGTGG - Intergenic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
1185051151 22:48554977-48554999 CAATGTAGCCCCTGAGGCTGGGG + Intronic
949280343 3:2339289-2339311 CAATGTTTCCATAGAAACTAAGG - Intronic
952067666 3:29591579-29591601 CAATGAGGCCACAGAGAATAAGG - Intronic
953258886 3:41318029-41318051 CACTGTTGTCCCAGAGGTTAAGG + Intronic
954705558 3:52478769-52478791 CAATGTTATCCCAGACAGTAGGG - Intronic
958903052 3:99910836-99910858 TAATGTTGCCCAAGAAACTTGGG + Intronic
969454572 4:7294079-7294101 CAAAGTTGCCTCAGAGGCTGGGG + Intronic
970449294 4:16151060-16151082 CATTGTTGCCCCATAGGCTGAGG - Intergenic
972153295 4:36123486-36123508 CTATTTTGTCCCAGAAACTAAGG - Intronic
982407342 4:155035123-155035145 CAATGTTGCATAACAGACTAGGG - Intergenic
985886792 5:2686353-2686375 CAATGAGGCCCCAAAGACAATGG + Intergenic
986944207 5:12995158-12995180 AAGAGTTGCCCCAGAGAGTATGG + Intergenic
987447285 5:18035312-18035334 CAAAGTTGCCCCAGAGCAGATGG - Intergenic
989954803 5:50345194-50345216 ATATGTGGCCCCAGCGACTAGGG + Intergenic
995905626 5:117119176-117119198 AAATTTTGCCCCATAGACTTAGG - Intergenic
999232719 5:150070988-150071010 CCATGTTGCTGCAGAGACTGGGG + Intronic
1001539014 5:172524051-172524073 CAATCTGGCTCCAGAGCCTATGG - Intergenic
1002769377 6:277821-277843 CAATGTAACACCAGAGACCACGG - Intergenic
1008960076 6:57257648-57257670 CAGTCTTGCCCCAAAGCCTATGG - Intergenic
1009626708 6:66145072-66145094 CATTTTTGCTCCAGAGTCTAAGG + Intergenic
1012376963 6:98573874-98573896 CTATCTTGCACCAGAAACTAAGG - Intergenic
1012927613 6:105283240-105283262 CAACGTTTCCCCAGAGAATCTGG + Intronic
1017628365 6:156370925-156370947 AATTGTTGACCCAGAGACTTGGG + Intergenic
1018106289 6:160490354-160490376 AAATGTTCCACAAGAGACTAGGG - Intergenic
1018106797 6:160495870-160495892 AAATGTTCCACAAGAGACTAGGG - Intergenic
1026111938 7:67465366-67465388 TAATGTTCCCCCAGAGCCCATGG - Intergenic
1030330159 7:108262109-108262131 AAATGCTGAGCCAGAGACTAAGG + Intronic
1030869374 7:114736209-114736231 CAATGTGGCCCCAGCCACTCAGG - Intergenic
1031692414 7:124805281-124805303 CTCTGTTGCCCCAGAGTCTTAGG + Intergenic
1032949954 7:136896400-136896422 CAATGTCGCCCCAGATACACTGG - Intronic
1039364089 8:36912384-36912406 CAATCCTGACCCAGAGACTAGGG + Intronic
1044617311 8:94155555-94155577 CACTGTGGCCCCAGAGGCAATGG + Intronic
1044959299 8:97514968-97514990 CAATGTTCCCCCTGAGACCCTGG + Intergenic
1047729351 8:127713966-127713988 CAGTGTTGCTCCAGACACTCTGG - Intergenic
1053160410 9:35810044-35810066 AAAAGTTTCCCCAGAGACAAGGG + Intronic
1053684067 9:40505397-40505419 CAATGTTGACACAGAGAGAAGGG + Intergenic
1053934041 9:43133682-43133704 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054279654 9:63119556-63119578 CAATGTTGACACAGAGAGAAGGG - Intergenic
1054297162 9:63340861-63340883 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054395182 9:64645369-64645391 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054429829 9:65150569-65150591 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054500554 9:65870963-65870985 CAATGTTGACACAGAGAGAAGGG - Intergenic
1055509432 9:76981010-76981032 CACTGTTACCCCACAGACTGGGG - Intergenic
1055777884 9:79785710-79785732 CAATGTTTCCCCAGTTACCATGG + Intergenic
1059359157 9:113726361-113726383 CAATGGTGCCCAAGATATTAAGG - Intergenic
1061385405 9:130286643-130286665 CAAGGTGGCCCCAGAGACTGTGG + Intronic
1191995316 X:67089136-67089158 GAATGTTGCCCAAGAGCCTGAGG - Intergenic
1192617151 X:72638287-72638309 GCCTGTTGTCCCAGAGACTAAGG + Intronic
1195284537 X:103371255-103371277 CCATGTTTCCTCAGAGACTCTGG + Intergenic
1198163456 X:134030291-134030313 CAATATTGTTCTAGAGACTAGGG - Intergenic
1198790935 X:140345020-140345042 CAATCTGGCCCCAGAGCCTGTGG - Intergenic