ID: 1122784468

View in Genome Browser
Species Human (GRCh38)
Location 14:104157481-104157503
Sequence CTGCCTCCAAGGAGTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122784463_1122784468 -7 Left 1122784463 14:104157465-104157487 CCATCTGCCTCCCTCTCTGCCTC 0: 1
1: 6
2: 117
3: 818
4: 6624
Right 1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG 0: 1
1: 0
2: 2
3: 30
4: 275
1122784462_1122784468 -4 Left 1122784462 14:104157462-104157484 CCACCATCTGCCTCCCTCTCTGC 0: 1
1: 0
2: 11
3: 187
4: 1421
Right 1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG 0: 1
1: 0
2: 2
3: 30
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122784468 Original CRISPR CTGCCTCCAAGGAGTCCTGC TGG Intronic
900180622 1:1309442-1309464 CTGCCGCCATAGGGTCCTGCGGG + Exonic
900285772 1:1899657-1899679 CTGCCCCCATGGCGTGCTGCAGG + Intergenic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
901129979 1:6956141-6956163 CTGCTTCCATGGAGAGCTGCCGG - Intronic
901529199 1:9843022-9843044 CTGCCTCCCAGGACTCCTCCAGG - Intergenic
901818052 1:11806066-11806088 CGGCCTCCAACGAGACCTGTGGG - Intronic
901989553 1:13101740-13101762 CTGCCTCCAGAAAGTCCTCCAGG + Intergenic
901992259 1:13125012-13125034 CTGCCTCCAGAAAGTCCTCCAGG - Intergenic
902798911 1:18817512-18817534 CTTCCTCCAGGAAGTCCTCCTGG - Intergenic
902879224 1:19359976-19359998 CTGCCTCCATAGAGCCCTCCTGG + Intronic
903126587 1:21252417-21252439 CTGCAGCCAAGGAGTACTGTGGG + Intronic
904350415 1:29901773-29901795 CTGCCTTCCAGAAATCCTGCAGG - Intergenic
904459976 1:30670789-30670811 CTGACTCGAAGCAGGCCTGCAGG + Intergenic
905441224 1:37997544-37997566 TTGCCTCCACCGAGTCCTGGAGG + Exonic
907413425 1:54298053-54298075 CAGTCTCCTAGGAGGCCTGCAGG + Intronic
908510455 1:64846721-64846743 CTGCCTCGAAGAAGGCCTGTGGG + Exonic
909152820 1:72030279-72030301 CTGCCTCCCAGGATCCCTCCAGG + Intronic
912697206 1:111850381-111850403 CAGCCTCCAAGGATTCCCGAGGG - Intronic
913542598 1:119836156-119836178 TTTCCTCCGGGGAGTCCTGCAGG + Intergenic
914380342 1:147109973-147109995 CTTCATCCAGGGAGTCCTGTGGG + Intergenic
914918508 1:151832465-151832487 CTGCCTCCAGGCACTCCTCCAGG - Intergenic
915399217 1:155610350-155610372 CTGCCCCCGAGGAGCCCTTCGGG + Intronic
915416332 1:155745930-155745952 CTGCCCCCGAGGAGCCCTTCGGG + Intergenic
916104346 1:161419999-161420021 CTTCCACCCAGGAGTCCAGCTGG - Intergenic
919612553 1:199763160-199763182 CTGCCTGAAAGGGGTTCTGCAGG + Intergenic
920307037 1:205025314-205025336 CTGCCTTCAAGGAGTCTCGGAGG - Intergenic
922160754 1:223077933-223077955 TAGCCTCCAAGGAGGACTGCTGG - Intergenic
923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG + Intergenic
924258824 1:242209286-242209308 CTGGCTGCAGGGAGTCCTGTGGG - Intronic
1063369546 10:5512222-5512244 CTGGCTCCAGGGAGTCCTGAAGG - Intergenic
1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG + Intronic
1067088289 10:43254165-43254187 CTGGCTCCAGGGTTTCCTGCAGG - Intronic
1067567502 10:47349477-47349499 CTGCCTCCAGGAGGTCCTGAAGG + Exonic
1068423172 10:56822231-56822253 CTGCCTGCCTGGTGTCCTGCAGG + Intergenic
1069532103 10:69227171-69227193 CGGCCACCAAGGGGTGCTGCTGG - Intronic
1070334135 10:75439563-75439585 CAGCATCCAAGGAGTTCCGCTGG - Intronic
1070359125 10:75670575-75670597 CTGGCTCCAAGGAGGCCTCTGGG + Intronic
1070637234 10:78139380-78139402 CTTCCTCCCGGCAGTCCTGCTGG + Intergenic
1070788460 10:79175842-79175864 CCGGCTCCCAGGAGTCCTGTGGG - Intronic
1071573979 10:86712513-86712535 CTGCCTCCAAGTCATCCAGCTGG - Intronic
1074012091 10:109492508-109492530 CAGCCTCCAGGGAGTCCTGGGGG + Intergenic
1074084351 10:110196434-110196456 CTGCCTTCAGGGAGCTCTGCTGG - Intergenic
1074591986 10:114822102-114822124 CCGCCTCCACGGCGTGCTGCAGG - Exonic
1074678840 10:115882600-115882622 CTGCCTACAAGGAGTCTGGAAGG - Intronic
1075677856 10:124308667-124308689 CAGGCTCCAAGGAGCCCTGGAGG - Intergenic
1075779701 10:125009294-125009316 CTGCCTCCCAGGCCACCTGCAGG - Intronic
1075913811 10:126148919-126148941 CTCCCTCCATGGAGTCCTCTAGG - Intronic
1076219240 10:128719644-128719666 TTGCCCCCATGGAGTCGTGCTGG - Intergenic
1076510506 10:131011087-131011109 CTGCCTCCCAGGAGGCCTCCCGG - Intergenic
1076571523 10:131436261-131436283 CAGCCCCGAAGGTGTCCTGCTGG - Intergenic
1076805472 10:132855987-132856009 CTGACTCCAAGAGCTCCTGCAGG + Intronic
1076997781 11:307327-307349 CTGCCCCAAAGGAGCCCTCCAGG - Intergenic
1077016202 11:400088-400110 CTGCCTCCGAGGCGTTCTGCTGG - Exonic
1077410901 11:2403449-2403471 CAGCCACCATGGAGGCCTGCAGG + Exonic
1077446379 11:2592954-2592976 CTGGATCCCAGGAGTCCTGAAGG + Intronic
1080153044 11:29076317-29076339 CTGCCTCTGCGGAGTCATGCAGG + Intergenic
1080268411 11:30424969-30424991 CTGCCTCCAAAGGGTAGTGCTGG + Intronic
1080779484 11:35418235-35418257 CTGCCTCCCAAGATTCCAGCTGG - Intronic
1081365735 11:42232890-42232912 CTGCATCCCAGCAGTCATGCTGG + Intergenic
1081710196 11:45211268-45211290 ATGCCTCCCAGGGGTCCTGGGGG - Intronic
1082655957 11:55857280-55857302 CTGACTCCCAGGAGCCATGCGGG - Intergenic
1082681681 11:56180741-56180763 CTGCCTCCAAGTAGACTTCCAGG - Intergenic
1082903893 11:58285345-58285367 CTGCCTCTACTGTGTCCTGCAGG - Intergenic
1083887415 11:65579589-65579611 CCTCCTCCAAGGAGACCTCCTGG - Intronic
1084065269 11:66700561-66700583 CGGCTTCCAGGGATTCCTGCGGG - Exonic
1084418869 11:69050185-69050207 CTGCCTCCAGGAAGTTCTTCAGG + Intronic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1085448416 11:76616265-76616287 CTGCCTCCAGGAAGTGCTCCTGG + Intergenic
1087331199 11:96782768-96782790 CTGGCTCCTGGGAGTGCTGCTGG - Intergenic
1087619469 11:100525571-100525593 CTGCCTCTTTGGAGTCATGCAGG - Intergenic
1089817725 11:121191233-121191255 CTCCCTCTAAGGAATCTTGCTGG + Exonic
1091328643 11:134712943-134712965 CTGCCTGAAGGGAGCCCTGCCGG + Intergenic
1092104788 12:5913643-5913665 CTGCCACTAAGGGGTCCTGCTGG - Intronic
1094682726 12:32679809-32679831 CTGCCTCCAAGGGCACCTGGGGG + Intronic
1094683971 12:32692251-32692273 CAGGCTCCAGGAAGTCCTGCTGG + Intronic
1096195462 12:49646583-49646605 CCGTCTCCCAGGATTCCTGCTGG - Intronic
1097295475 12:57958132-57958154 CTGCCTCTGGGGAGTCATGCAGG - Intergenic
1098439661 12:70504461-70504483 CTCCCTGCAGGGAGGCCTGCAGG - Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1100581412 12:95943330-95943352 CGTCCTCCACTGAGTCCTGCCGG + Exonic
1100667505 12:96770944-96770966 CTCCATCCAAGCAGTCCAGCAGG - Intronic
1102255196 12:111410942-111410964 CTTCCTCCAGGGAGGCCTCCTGG - Intronic
1102507816 12:113394874-113394896 CCTCCTCCAAGGAGTCCTCCTGG + Intronic
1103242905 12:119429708-119429730 CTACCTTCCAGGAGTCCTCCTGG - Intronic
1104832910 12:131766599-131766621 GTGCCTCCCATGGGTCCTGCTGG + Intronic
1105211716 13:18261031-18261053 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
1105829091 13:24148510-24148532 CTGCCTCCCAGGGTACCTGCAGG + Intronic
1110223499 13:73096421-73096443 CAGCCTCCAAAGAGTACAGCAGG + Intergenic
1112452776 13:99526963-99526985 CTGCCTCACTGGAGTCTTGCTGG - Intronic
1115248255 14:31318836-31318858 CTGGCTCCAGGGACTCATGCTGG + Intronic
1116346693 14:43803189-43803211 CTGCCTCTACTGAGTCATGCAGG - Intergenic
1118847666 14:69559893-69559915 CAAGCTCCCAGGAGTCCTGCAGG - Intergenic
1118901744 14:69992079-69992101 CTGCCTCCCAGTTTTCCTGCGGG + Intronic
1118902994 14:70002178-70002200 CTCCCTCCAGGGGGTCCTCCCGG + Intronic
1119225352 14:72940920-72940942 CTGCCTCCCAAGATTCCTTCAGG - Intronic
1121516621 14:94556471-94556493 CTGCCTCTACTGAGTCATGCAGG + Intergenic
1122343268 14:101042655-101042677 CTGCCTCCAGGAAGCCCTCCTGG - Intergenic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1122807773 14:104269242-104269264 CTTCCTCCAAAGAGTGCTGGAGG - Intergenic
1124126204 15:26939853-26939875 CTGCATCCAAGGAGTTCACCAGG - Intronic
1125592596 15:40864180-40864202 CTGGCTCCCAGCAGACCTGCAGG - Intergenic
1127308262 15:57728962-57728984 CTGCCTGCAAGATCTCCTGCAGG - Intronic
1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG + Intronic
1129520335 15:76182054-76182076 CAGCCTCCAAGGAGACCAGTGGG + Intronic
1130331821 15:82928193-82928215 CTGCGTCCAAGCAGTCCAGGTGG - Intronic
1131006464 15:88982602-88982624 CTGGCTACAGGGAGTCCTCCTGG - Intergenic
1132561276 16:595368-595390 CTGCTTCACAGGAGGCCTGCAGG - Intronic
1133314523 16:4874378-4874400 CTTCATCCAATGAGTCCTCCAGG - Exonic
1134190778 16:12119678-12119700 CTGCCTCCCAGGAGCCGGGCTGG + Intronic
1135402958 16:22178722-22178744 CTTCCTCCAGGGAGCCCTCCTGG - Intronic
1136349376 16:29697058-29697080 CTGCCTGCACGGCCTCCTGCAGG - Exonic
1136509629 16:30728959-30728981 TTTCCTCCAGGGAGTCCTGGGGG - Exonic
1137572765 16:49577668-49577690 CTGCCAACAAGGTTTCCTGCAGG - Intronic
1139400231 16:66675489-66675511 TTGCCTCCATGGAGTTCTGTAGG - Intronic
1140405400 16:74707311-74707333 CTGGCTTCAAGTAGTCCTCCTGG + Intergenic
1140545254 16:75801744-75801766 CTGACTCCAAAGATACCTGCAGG + Intergenic
1140739942 16:77932460-77932482 CTGTCAACAAGAAGTCCTGCAGG - Intronic
1140932825 16:79643533-79643555 TGGCCTCCAAGGAATCCTGCTGG + Intergenic
1141154829 16:81590091-81590113 CCTCCTCTCAGGAGTCCTGCTGG - Intronic
1141521610 16:84583838-84583860 CTGCCTCCAAGGAGAAGTGGAGG - Intronic
1141691824 16:85601026-85601048 CCTCCTCCAGGGAGTCCTCCTGG - Intergenic
1141890719 16:86924851-86924873 CAGCCTCCAAGGCTTCTTGCTGG - Intergenic
1143390076 17:6555218-6555240 CTGTCCCCAAGGAGTCCTGTCGG - Intronic
1143775630 17:9196946-9196968 CTGCATTCAGGGTGTCCTGCTGG + Intronic
1146653770 17:34623272-34623294 GTGCCTCCAAGGAATCCAGATGG + Intronic
1147490681 17:40863313-40863335 CTTCGGCCAAGGAGTCCTCCAGG + Exonic
1147647082 17:42040367-42040389 CCGCCTCCAGGGCTTCCTGCAGG - Intronic
1148156875 17:45429756-45429778 CTGCTTCCTAGGAGGCCGGCGGG + Intronic
1148612454 17:48973436-48973458 TCACTTCCAAGGAGTCCTGCTGG + Intergenic
1151826061 17:76525103-76525125 CTGCCCCTTGGGAGTCCTGCGGG - Intergenic
1151967573 17:77439447-77439469 CTGCCCCCGTGGCGTCCTGCAGG + Intronic
1152069427 17:78127656-78127678 CAGCCACCAGCGAGTCCTGCCGG + Intronic
1152146418 17:78571489-78571511 CAACCTCCCAGGAGTCCTGAGGG - Intronic
1152559220 17:81069539-81069561 CTGGCTTCAAGGACGCCTGCTGG + Intronic
1152631419 17:81412209-81412231 CTGCCCACAAGGCGACCTGCTGG - Intronic
1154094074 18:11393821-11393843 CTGCCTCTGCTGAGTCCTGCAGG - Intergenic
1156449849 18:37260865-37260887 CTGGCTCCCAGGCATCCTGCTGG + Intronic
1156505250 18:37586606-37586628 CAGGCTCAAAGGAGTCCTGTTGG - Intergenic
1158331527 18:56368108-56368130 CTGCCTCTATTGAGTCCTGCAGG + Intergenic
1158417934 18:57266151-57266173 CTGCTTTCAAGGAGCTCTGCAGG + Intergenic
1159053366 18:63442184-63442206 CTGCCTCAAAGGATTACTACTGG - Intergenic
1159944443 18:74433499-74433521 CTGCCTCCTAGAAGTCCACCAGG - Intergenic
1159990901 18:74906118-74906140 ATGCCTACAAGGGGTACTGCAGG - Intronic
1160792488 19:929124-929146 CTGCCTCCAAGAAGGCCTCCAGG + Intronic
1161000261 19:1907301-1907323 CTGCCTCCGAGGAGCCCTCCTGG + Intronic
1161582298 19:5087482-5087504 CTGCCTCCAAGGGACGCTGCAGG - Intronic
1161982944 19:7639315-7639337 CTGCAGCCAGGGAGTGCTGCAGG - Intronic
1162032462 19:7923417-7923439 CTGTCCCCAAGGTGCCCTGCCGG - Intergenic
1162407916 19:10486685-10486707 CTGTCACCATGGAGCCCTGCCGG - Exonic
1162562660 19:11426526-11426548 CAGCCTCCATGGAGTCCAGCCGG + Exonic
1163335545 19:16669181-16669203 CTGCAACCAAGATGTCCTGCAGG - Intronic
1164479218 19:28598565-28598587 CTGCCTCCCATGAGCCTTGCAGG - Intergenic
1164558889 19:29274910-29274932 CTGCCTCCCAGGAGCTCTGTAGG + Intergenic
1165023507 19:32942814-32942836 CTGCATACAAGGTGTCATGCTGG + Intronic
1166048457 19:40243450-40243472 TCCCCTCCAGGGAGTCCTGCGGG - Intronic
1166696781 19:44856434-44856456 CTTCATCCAAGGAGGCCTGAGGG - Intronic
925878105 2:8328894-8328916 CTTCCTCCAAGGCCTTCTGCTGG + Intergenic
927342293 2:21996236-21996258 CTTCCTCCAAGAAGTCTTCCTGG - Intergenic
929981657 2:46687033-46687055 CTTCCTCCGAGGACTCCTCCAGG - Intergenic
931179058 2:59881716-59881738 CTGCCTTCCATCAGTCCTGCTGG + Intergenic
931782088 2:65587514-65587536 CTTCCTCCAAGGAAGCTTGCAGG - Intergenic
932446513 2:71785101-71785123 CTGACACCAGGGAGTCCTGCTGG - Intergenic
934301909 2:91781424-91781446 CCTCCTCCAAGAAGTCCTCCTGG - Intergenic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
937017214 2:118617017-118617039 CTTCCTCCAGGGAGTCCTCAAGG + Intergenic
937122780 2:119452240-119452262 CTGCCACCCAGGAGCACTGCTGG + Intronic
937846485 2:126584510-126584532 CTGCCACCAAGCAGGTCTGCAGG - Intergenic
938630369 2:133160197-133160219 CTGCCTTCAGGGAGCCCTGAAGG - Intronic
940775174 2:157876631-157876653 CCGCCTCCGAGGAGCCCCGCTGG - Intergenic
941605040 2:167586251-167586273 ATGCCCCCAAGGAGGCCTCCTGG - Intergenic
942261767 2:174172284-174172306 CTACCTCCTAGGGGTCCTCCAGG + Intronic
943734541 2:191339936-191339958 CTGTCTCACAGGAGACCTGCAGG - Intronic
946053578 2:216883013-216883035 CTGGCTCCAGGGAGGTCTGCTGG + Intergenic
946185061 2:217976087-217976109 CTTCCTCCAAGGAGTCTTTCTGG + Intronic
946312437 2:218890219-218890241 CCCACTCCCAGGAGTCCTGCAGG - Exonic
946575571 2:221071821-221071843 CAGCTTCCATGTAGTCCTGCAGG - Intergenic
948589404 2:239039552-239039574 GTGCCTTCAAGGAGCCCAGCCGG + Intergenic
949042198 2:241854574-241854596 CTGCCTCCCAGGAGCCCTCTTGG - Intronic
1168831631 20:848304-848326 CTCCCTCCACAGAGGCCTGCAGG - Intronic
1170483783 20:16794519-16794541 CTGCCTCGAAGGGGTCCTTAGGG - Intergenic
1170885712 20:20338289-20338311 CTGCCGCCAGGGAGGCCTGCGGG - Intronic
1171206595 20:23286538-23286560 CTGCCACCCAGGAGCCCTGCCGG - Intergenic
1171386765 20:24774845-24774867 CATCCTCCAAGGAGTCAAGCAGG + Intergenic
1172283474 20:33724554-33724576 CTGCCCTCAAGGGGCCCTGCAGG + Intergenic
1172447381 20:35000320-35000342 CTGCATCCAGGGAGGCCTGCAGG - Exonic
1173897178 20:46559994-46560016 CAGCCTCAAGGGAGTCCTCCAGG + Exonic
1173898412 20:46568643-46568665 CTGGCTGCAAGGAGTGCTGCAGG + Intronic
1175413898 20:58788852-58788874 CTTCCTCCAGGAAGTCCTACCGG + Intergenic
1179121191 21:38547461-38547483 CTGCCTCTAAGGAGTCTCTCTGG + Intronic
1180075618 21:45459991-45460013 ATGTTTCCAAGGAGTCCTACAGG + Intronic
1180083021 21:45495111-45495133 CTGCCTCCAGGGCTTCCTCCTGG - Intronic
1180231318 21:46428385-46428407 GTGCCCCCAGGGAGACCTGCAGG + Exonic
1180814521 22:18781295-18781317 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
1181200709 22:21215631-21215653 CCTCCTCCAAGAAGTCCTCCTGG + Intronic
1181701032 22:24621342-24621364 CCTCCTCCAAGAAGTCCTCCTGG - Intronic
1184017312 22:41795779-41795801 GGCCCTCCAAGGAGGCCTGCAGG - Exonic
1184409289 22:44317354-44317376 TTGCCGCCAGGGAGTCCTCCTGG - Intergenic
1184788770 22:46686258-46686280 CTGCCTCAGAGGAGTCCTGCGGG + Exonic
1185165647 22:49260776-49260798 CCGCCTCCAAAGGGTCCTCCTGG - Intergenic
1185420657 22:50732514-50732536 CTGCCTCCAAGGGGCCCTTGGGG - Intergenic
1203226208 22_KI270731v1_random:79804-79826 CCTCCTCCAAGAAGTCCTCCTGG - Intergenic
1203264620 22_KI270734v1_random:6982-7004 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
950665155 3:14490782-14490804 CAGCCTCCATGGAGACCTGGAGG - Exonic
950838396 3:15942616-15942638 CTGGCTGCAGGGAGTGCTGCTGG + Intergenic
951736665 3:25873768-25873790 CTGTTTCCTAGGAGTTCTGCTGG + Intergenic
951761177 3:26148690-26148712 CTGCCTCTACTGAGTCATGCAGG - Intergenic
953666668 3:44930578-44930600 CTCCATCCAAGCTGTCCTGCTGG + Intronic
954107880 3:48419079-48419101 CTGGGCCCAGGGAGTCCTGCAGG + Intronic
954993406 3:54860442-54860464 CTGACTCCCAGGATTGCTGCAGG + Intronic
955751487 3:62189136-62189158 ATGCCTCCCAGGGGTTCTGCGGG + Intronic
958701210 3:97592716-97592738 TTGCCCCCCAGGATTCCTGCTGG + Exonic
961013663 3:123450929-123450951 TTGCCCCCAAGCTGTCCTGCTGG + Intergenic
961837023 3:129670655-129670677 CTTCCTCTAAAGAGTCCTTCAGG + Exonic
963814528 3:149814283-149814305 GTGCCTCCAAAGAGTTCTTCTGG + Intronic
966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG + Intronic
966826262 3:183967498-183967520 CTGCCTGGAAGGAGGCCTGGTGG - Intronic
967885861 3:194332975-194332997 CTTCATCAAAGGAGGCCTGCTGG - Intergenic
968148686 3:196320440-196320462 CTGCCTCCTACGAGCTCTGCTGG + Intronic
968621619 4:1605807-1605829 CTTCTTCCCAGGAGTCCTGGTGG + Intergenic
969643919 4:8415225-8415247 ATGCCTGCAAGGAGTCCTGGGGG + Intronic
969712855 4:8854103-8854125 CTGCCTCGAATGGGTCCTGGAGG + Intronic
971224954 4:24743441-24743463 CAGTCTCCAAAGAGACCTGCAGG + Intergenic
974819610 4:67049676-67049698 CTGCCTCCAATGGCTCCTGTTGG - Intergenic
979852438 4:125590394-125590416 CTTCTTCCAAGGAGTATTGCAGG - Intergenic
980009303 4:127578721-127578743 CTGCCTGGAGGGAGTCCTGCTGG + Intergenic
980053987 4:128062197-128062219 CTGCCTCCAGGGTTTCCAGCGGG - Intronic
980462477 4:133134177-133134199 ATTCCTCCAAGGGTTCCTGCTGG + Intergenic
980524294 4:133969488-133969510 CTGGCACCAAGGACTCCTGCTGG - Intergenic
981005067 4:139866105-139866127 CTGCCTCCTGGGGGTTCTGCAGG - Intronic
981288447 4:143046672-143046694 CTCCTTCCAAGGAAGCCTGCTGG - Intergenic
983692086 4:170482614-170482636 CAGCCTCCAAGGCCTCCAGCAGG - Intergenic
984721668 4:182978336-182978358 CTGCCTCTACTGAGTCATGCAGG - Intergenic
984845361 4:184103704-184103726 CGGGCTCCAAAGAGTCCTGCTGG - Intronic
985821936 5:2166430-2166452 CCATCTCCAAGGAGTCCTCCTGG - Intergenic
985950489 5:3218592-3218614 CTGCATCCGTGGAGCCCTGCAGG - Intergenic
987310721 5:16678865-16678887 GGCCCTCCAAGCAGTCCTGCAGG - Intronic
987524779 5:19033140-19033162 CTTCAACCAAGGAATCCTGCTGG - Intergenic
988035666 5:25824066-25824088 CTGTCTCTAAGGAGACCTGGAGG - Intergenic
990574965 5:57115414-57115436 CTACCTCCCAGGAATGCTGCAGG - Intergenic
992132091 5:73703535-73703557 CTACCTTCAAGGAGTCCAGGAGG + Intronic
994971131 5:106739483-106739505 ATGTCTCCCAAGAGTCCTGCTGG - Intergenic
995024376 5:107402098-107402120 ATATCTCCAAGGAGTCCTGTCGG - Intronic
1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG + Intergenic
1001555020 5:172631268-172631290 CTGCCTCCCATGACTGCTGCTGG - Intergenic
1002534735 5:179869973-179869995 CTGTCTCCCTGGCGTCCTGCTGG + Intronic
1003260409 6:4511210-4511232 CTGCCCCCAAATAGACCTGCTGG - Intergenic
1004813935 6:19291910-19291932 CTGGTTCTAAGGAGTCCTGCAGG - Intergenic
1005861323 6:29904611-29904633 CTGCCTTCAGAGAGTCCTGGAGG - Intergenic
1006673226 6:35743035-35743057 CTGACTCCAACCTGTCCTGCGGG + Intronic
1008699459 6:54081234-54081256 CCGCCACCATGGAGACCTGCGGG - Intronic
1010234804 6:73566472-73566494 TTCCCTCCAAGCAGTCCTTCAGG - Intergenic
1010679314 6:78781190-78781212 CTGCCTCTGATGAGTCATGCAGG - Intergenic
1011558327 6:88591236-88591258 CTGCCTCCCAGGATTGCTGATGG + Intergenic
1011677534 6:89749547-89749569 CTGCCTCCATAAAGTCCTGGGGG + Exonic
1015502904 6:133952299-133952321 CTGCGCCCAAGTAGCCCTGCAGG - Intronic
1015786577 6:136924540-136924562 CAGCCCCCGAGGAGTCCCGCTGG + Exonic
1016399002 6:143657907-143657929 CTGGCTGCTAGGAGTGCTGCTGG - Intronic
1018063656 6:160110124-160110146 CTGCCTACCTGGAGGCCTGCTGG - Intronic
1019484816 7:1284659-1284681 CTGCCTGCAGGGAGCCCTGGCGG - Intergenic
1019598965 7:1872019-1872041 CTGCCGCCTGGGAGTCATGCTGG - Intronic
1022949327 7:35320759-35320781 CAGCCTACAAGGAGTCCTGGGGG - Intergenic
1023098455 7:36687814-36687836 CTTCCCTCAAGGAATCCTGCTGG - Intronic
1024427594 7:49245338-49245360 CTGCCTCACAGGAATCCTACTGG - Intergenic
1024455182 7:49597835-49597857 CTTCCTCCAAGGAGCCTTCCTGG - Intergenic
1025811718 7:64879900-64879922 CTGCCTGCAACAAGTACTGCGGG - Intronic
1027173374 7:75888312-75888334 CAGGCTCCAAGGAGTCCTCCAGG + Exonic
1029373424 7:100163833-100163855 CTGCCTTCAAAGAGACCTGCAGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1034852527 7:154508339-154508361 GTTCCTCCATGGAGTCCTTCAGG + Intronic
1035388996 7:158492582-158492604 CTCTCACCAAGGAGTGCTGCAGG - Intronic
1035640079 8:1178145-1178167 CTGCCTTCAGGCAGTCCTCCGGG - Intergenic
1037054123 8:14416213-14416235 CTGCCTTAAAGGAGGCCTTCTGG - Intronic
1038154978 8:24980647-24980669 CTGCCTCCAAGGTGTCCAAATGG - Intergenic
1038416449 8:27399745-27399767 CTGCTTCCAATGTCTCCTGCAGG + Intronic
1039095561 8:33880967-33880989 CTGCCTCTGTGGAGTCATGCAGG + Intergenic
1040105280 8:43538071-43538093 CTTCCTCCATGGTGTCCAGCAGG + Intergenic
1040723277 8:50350927-50350949 CAGCCTCCAAGGGGACCTACGGG - Intronic
1041810033 8:61897571-61897593 CTTCCTCCAGGAAGTCCTTCTGG + Intergenic
1043114263 8:76230076-76230098 CAGCTTCCAAGGTGTTCTGCTGG - Intergenic
1043962833 8:86437130-86437152 CTGCCTCCAAGGAGGCATGCTGG + Intronic
1044295579 8:90523327-90523349 CTTCCTGCCAGGAGTCCAGCAGG + Intergenic
1045314037 8:101027819-101027841 CTGCCTCTAAGTAGTCATGTGGG + Intergenic
1048931463 8:139318817-139318839 CTGCCTCCATGGAGACGTGTGGG + Intergenic
1049343509 8:142126456-142126478 CTGCCTCCAAGAGGTGCTGTGGG - Intergenic
1049623681 8:143610657-143610679 CTGCCACCAAGCAGGGCTGCAGG - Intergenic
1050147335 9:2583390-2583412 CTGCCTCCAAGGAGTATTTGGGG - Intergenic
1056766278 9:89446598-89446620 CTGCCTCCCAGGACTTCTCCAGG + Intronic
1057050008 9:91916430-91916452 CTCCCTGCAGGGAGTCCTGAGGG + Intronic
1057845354 9:98518511-98518533 CTTCCTCCATGAAGTCCTTCTGG + Intronic
1057853499 9:98583731-98583753 GTGTCTGCAAGGAGTCCTTCAGG - Intronic
1060201325 9:121653166-121653188 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201330 9:121653196-121653218 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201335 9:121653226-121653248 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201340 9:121653256-121653278 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060403713 9:123362538-123362560 CTGCCTCAAAGGGGGACTGCAGG + Intronic
1060788457 9:126468831-126468853 CAGCCTGCCAGGAGTCCTGATGG - Intronic
1060815180 9:126631450-126631472 CTGATTCCCAGGAGTCCAGCTGG + Intronic
1062173102 9:135146154-135146176 CTGCCTCCTAGGATTCCTCCTGG + Intergenic
1062622131 9:137427914-137427936 CTGGTTCCAAGGAGACCTGAGGG - Intronic
1062624645 9:137437238-137437260 CCTCCTCCAAGCAGCCCTGCAGG + Exonic
1186349459 X:8728260-8728282 CTGCCTCCTAGGAGTGTTGTGGG + Intronic
1188918021 X:35935834-35935856 CTGACTCCATGGAGTCCGGAAGG - Intronic
1189412380 X:40784101-40784123 CTGTCTCAGAGGACTCCTGCCGG + Intergenic
1190153963 X:47972837-47972859 CTGCTTCCAGGGAGGCCTGAGGG + Intronic
1190895494 X:54614165-54614187 CTGCCTCAACTGAGTCATGCAGG + Intergenic
1192970279 X:76221328-76221350 CTGCCTCGGCTGAGTCCTGCAGG + Intergenic
1196700421 X:118661869-118661891 CTACTTCCCAGGAGTCCAGCTGG + Intronic
1197171215 X:123436538-123436560 GTGCTTCCAAGGTGGCCTGCCGG + Intronic