ID: 1122788677

View in Genome Browser
Species Human (GRCh38)
Location 14:104175427-104175449
Sequence CACCAGAGGCTGCATCCCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 301}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122788660_1122788677 25 Left 1122788660 14:104175379-104175401 CCGACGGAGCTCAGGCCAGCCCC 0: 1
1: 0
2: 0
3: 31
4: 363
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788671_1122788677 0 Left 1122788671 14:104175404-104175426 CCGAGGGGGCCGGAAGCCCTCGC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788667_1122788677 6 Left 1122788667 14:104175398-104175420 CCCCGCCCGAGGGGGCCGGAAGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788668_1122788677 5 Left 1122788668 14:104175399-104175421 CCCGCCCGAGGGGGCCGGAAGCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788670_1122788677 1 Left 1122788670 14:104175403-104175425 CCCGAGGGGGCCGGAAGCCCTCG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788672_1122788677 -9 Left 1122788672 14:104175413-104175435 CCGGAAGCCCTCGCCACCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788669_1122788677 4 Left 1122788669 14:104175400-104175422 CCGCCCGAGGGGGCCGGAAGCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301
1122788665_1122788677 10 Left 1122788665 14:104175394-104175416 CCAGCCCCGCCCGAGGGGGCCGG 0: 1
1: 0
2: 2
3: 38
4: 321
Right 1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG 0: 1
1: 0
2: 4
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122788677 Original CRISPR CACCAGAGGCTGCATCCCCC AGG Exonic
900100801 1:961191-961213 CACCAGGGGCTGGGTCCCCGCGG + Intronic
900494242 1:2969262-2969284 CACCAGTGCCTGCTTCACCCTGG + Intergenic
901144557 1:7056358-7056380 CACGAGAAGATGCAGCCCCCAGG + Intronic
901866478 1:12110035-12110057 CCCCAGTGGCACCATCCCCCAGG + Exonic
902512655 1:16974772-16974794 CACCGCAGCCTGCAACCCCCAGG + Exonic
903576024 1:24340396-24340418 CACCAGAGGCTCCATCTCTCAGG - Intronic
905923514 1:41734119-41734141 GAGCAGAGGCTGCACCCACCAGG + Intronic
912997319 1:114544062-114544084 CACCACAGTCTCCATCTCCCGGG + Intergenic
913479856 1:119277715-119277737 CTCTAAATGCTGCATCCCCCTGG - Intergenic
913999994 1:143685797-143685819 CACTGCAGGCTGCACCCCCCGGG + Intergenic
916330502 1:163610813-163610835 CAGCTGAGGCTACATCCCCTAGG + Intergenic
917130542 1:171738042-171738064 CACCACAGCCTTCATCTCCCAGG + Intronic
918060116 1:181053700-181053722 CAGGAGAGTCTGCAGCCCCCTGG - Intronic
918873449 1:190007198-190007220 CACCAAAGTCTGCATCTTCCTGG + Intergenic
919767324 1:201135777-201135799 CAGCAGCTGCTGCATCCCTCGGG - Exonic
920182147 1:204138545-204138567 CAGCAGAGGCTCCATCACCCTGG + Intronic
922841973 1:228650177-228650199 CATCAGCGGCTGCAGCCCCATGG + Intergenic
923619222 1:235564340-235564362 CACCAGTGATTTCATCCCCCAGG - Intronic
924323593 1:242873400-242873422 GATCAGAGGCTGCCTTCCCCAGG + Intergenic
924744325 1:246818306-246818328 CACCGCAGCCTGCAACCCCCAGG - Intergenic
924813665 1:247424661-247424683 CACCATGTGCTTCATCCCCCTGG + Exonic
1062967366 10:1617989-1618011 CCCCTAAGGCTGCATCTCCCCGG + Intronic
1063181041 10:3600500-3600522 CCCCAGAGGTTGCAGCCACCTGG - Intergenic
1067046774 10:42989607-42989629 CCCCACAGCCTCCATCCCCCTGG - Intergenic
1067795752 10:49320403-49320425 CCCCAGAGTCTGCATCACCTGGG - Intronic
1067967388 10:50928197-50928219 CACCAGGGGCTCAGTCCCCCTGG + Intergenic
1069511019 10:69042600-69042622 GACCAGGGGCTGCATTCCACAGG - Intergenic
1070244875 10:74721386-74721408 TGCTAGAGGCTGCATCTCCCGGG - Intergenic
1071545327 10:86524534-86524556 CAGCTCAGGCTCCATCCCCCTGG + Intergenic
1073466915 10:103699681-103699703 CTCCAGAGGCAGCAACCTCCAGG + Intronic
1075690486 10:124390610-124390632 CCCCAGACCCTGCATCCCCATGG + Intergenic
1076300433 10:129421533-129421555 CACCAAGGCCTGCATGCCCCTGG - Intergenic
1076859534 10:133134075-133134097 GACCCCAGGCTGCATCCCCCCGG + Intergenic
1077351868 11:2096829-2096851 TACCAGAGGCTGAACCCCCAAGG + Intergenic
1077467021 11:2738244-2738266 CTCCAGACCCTGCCTCCCCCTGG - Intronic
1077530253 11:3091625-3091647 CAGCACAGTCTCCATCCCCCCGG - Intronic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078229060 11:9421866-9421888 CACCGCAAGCTGCACCCCCCAGG - Intronic
1078287452 11:9971601-9971623 CACCACAGCCTCCATCTCCCAGG - Intronic
1078897956 11:15614874-15614896 CACCAGAGCCTGCATCCCTGTGG - Intergenic
1079094612 11:17502375-17502397 CACCTTGGGCTTCATCCCCCAGG - Intronic
1080679233 11:34458624-34458646 GAGCAGAGGCTGCATAACCCTGG + Intronic
1083227805 11:61295478-61295500 CACCAGAGGCTGCGCGCCCCGGG + Intergenic
1083285995 11:61659484-61659506 CACCAGCGCCAGAATCCCCCAGG + Intergenic
1083488676 11:62999156-62999178 CACCAGCTTCTGCATCCCCACGG + Intronic
1083842685 11:65313842-65313864 ATCCAGAGGCTGAATCCCCAGGG + Intergenic
1084115918 11:67042936-67042958 CACCAGGGGGTGCTGCCCCCAGG + Intronic
1084495764 11:69502132-69502154 CACCAGAGGCAGCATGCCCCAGG - Intergenic
1084885940 11:72206938-72206960 TTCCAGGGGCTTCATCCCCCAGG + Intergenic
1087689257 11:101300598-101300620 CACCAGATGCTGGCTGCCCCAGG + Intergenic
1090919693 11:131196949-131196971 CACCAGAGGCTCCAAGGCCCAGG - Intergenic
1092154150 12:6271553-6271575 CACCTGAGGCTGCCTACCTCAGG + Intergenic
1093044291 12:14424470-14424492 CACCAGAGGTGGCATCACCAGGG - Exonic
1096428353 12:51522937-51522959 AACCAGAGTCTTCATCCCACGGG + Intergenic
1096538187 12:52288541-52288563 CACCAGGGACTGCTTTCCCCTGG - Intronic
1097178278 12:57156262-57156284 CACCAGAGGCGTCAGCCCCGAGG + Exonic
1097187019 12:57201537-57201559 TACCAAACGGTGCATCCCCCGGG + Exonic
1097243864 12:57594892-57594914 CACCACAACCTCCATCCCCCGGG - Intronic
1098080979 12:66785434-66785456 CACCACAGCTTCCATCCCCCAGG - Intronic
1101490061 12:105201910-105201932 CACCTGTGGCATCATCCCCCGGG + Intronic
1102532998 12:113560401-113560423 CAACAGAGGCTGGATCCACAAGG + Intergenic
1102888477 12:116539359-116539381 CCCCAGAGGCTGCCTGCCCTGGG - Intergenic
1102933312 12:116878706-116878728 CGCCAGAGGCTGCAGAACCCTGG + Intronic
1105434381 13:20364193-20364215 CTGCAGATGCTGCCTCCCCCAGG + Intergenic
1105693427 13:22864549-22864571 TACCAGAGGGTGCCTCCCCTGGG + Intergenic
1107195377 13:37644795-37644817 CACCACAGGCTCCACCTCCCGGG - Intronic
1113774774 13:112937530-112937552 CACCAAAGGCTGCAGCTTCCAGG - Intronic
1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG + Intergenic
1114697875 14:24644403-24644425 CACCATTGCCTGCATCACCCTGG + Intergenic
1115893817 14:38061627-38061649 CACCAGAGGCAGCTTCCACATGG - Intergenic
1118002085 14:61532765-61532787 CACCAGAGGCTGTTTCCTCTTGG - Intronic
1118607684 14:67515365-67515387 CAGCGGCGGCTGCAGCCCCCCGG - Intronic
1118672549 14:68145284-68145306 CATCAGAGACTGCATCCTACTGG + Intronic
1120140703 14:80926817-80926839 CACCATTGCCTGCATCACCCTGG + Intronic
1120792439 14:88597597-88597619 CACCAGAGGCCAGATCCCACTGG + Intronic
1120897888 14:89550516-89550538 CAACAGACTCTGCATCGCCCAGG + Intronic
1121022377 14:90588175-90588197 CACCAGAGGTTGCATCAGCAGGG - Intronic
1121270482 14:92634526-92634548 CACCGAAGGCTGCATGCACCAGG + Intronic
1121304078 14:92894539-92894561 GCCTAGAGTCTGCATCCCCCAGG + Intergenic
1121642273 14:95493676-95493698 CACCAGTGGCTGCATCGCTGTGG + Intergenic
1121667191 14:95681490-95681512 CACTGAAGGCTGCATCTCCCTGG + Intergenic
1122093298 14:99353906-99353928 CAGCAGATGCTGCATCCACCAGG - Intergenic
1122144752 14:99682966-99682988 CAGCAGAGCATCCATCCCCCCGG - Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1122820255 14:104340062-104340084 CACCACAGCCTCAATCCCCCAGG - Intergenic
1123029082 14:105442372-105442394 CACCAGGGGCCGCATCTTCCTGG - Intronic
1123493660 15:20801122-20801144 CACCAGAGGACCCAGCCCCCTGG + Intergenic
1123550158 15:21370187-21370209 CACCAGAGGACCCAGCCCCCTGG + Intergenic
1124374916 15:29123845-29123867 CTCCAGGGGCTGCAGCCTCCAGG + Intronic
1125535678 15:40440440-40440462 CGCCGGAGGCTGCTGCCCCCAGG - Intronic
1126455723 15:48859956-48859978 CACTAGAGCCTGCAACCCCTGGG - Intronic
1128547772 15:68579310-68579332 CGCCGGCGCCTGCATCCCCCGGG + Intronic
1129603989 15:77015906-77015928 CCCCAGAGGCTGCAGGCTCCAGG - Intronic
1130384686 15:83400856-83400878 CACCAGAAGCTGCCTCCTCAGGG - Intergenic
1130821445 15:87500410-87500432 CTGCAGAGCCTGCAGCCCCCTGG - Intergenic
1131617478 15:94031966-94031988 CAACTGAGGCTGGATCCCACTGG - Intergenic
1132231673 15:100189107-100189129 CAGCAGCGTCTGCATCACCCTGG - Intronic
1202958499 15_KI270727v1_random:97442-97464 CACCAGAGGACCCAGCCCCCTGG + Intergenic
1132605246 16:790982-791004 CACCAGGGGCTCCACCCCCACGG - Intronic
1132744506 16:1431122-1431144 CAGCAGCGTCTGCCTCCCCCAGG - Intergenic
1133861524 16:9599765-9599787 CACCAAGGGCTCCATCCACCAGG - Intergenic
1134126804 16:11621681-11621703 CACCTGGGGCTGCATCCTGCCGG - Intronic
1135727520 16:24868521-24868543 CACCGCAAGCTCCATCCCCCAGG - Intronic
1138562795 16:57812115-57812137 CACTGGAGGCTCCATCCCCTAGG + Intronic
1139507298 16:67405381-67405403 CACCACAGGCTGGATGTCCCAGG + Intronic
1140124883 16:72110850-72110872 AACCAGGTGCTGCATCCACCAGG - Intronic
1140789991 16:78382378-78382400 CAACAGAGGCTCCATCCACCTGG + Intronic
1140959706 16:79900154-79900176 CAACAGAGCCTGCACCCACCAGG + Intergenic
1141444206 16:84047665-84047687 CAGCAGAGGCTGGATCCCTCAGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142115365 16:88353481-88353503 CACCAGCGGCTTCCTGCCCCAGG + Intergenic
1142272703 16:89099022-89099044 GCCCAGAGGGTGCTTCCCCCAGG + Intronic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1143321605 17:6072037-6072059 CACCTGTGGCTGCATCCTCCAGG + Intronic
1144458822 17:15440856-15440878 AACTTGAGGCTGCATCCACCTGG + Intronic
1144576932 17:16435372-16435394 CAACAGAGGCAGCATCTCCCTGG + Intronic
1144765516 17:17730458-17730480 CGCCATGGGCTGCATCCCCATGG - Intronic
1145018081 17:19411781-19411803 CGCCTGAGGCTGGATCCGCCAGG + Intronic
1145257706 17:21336377-21336399 GATCAAAGGCTGCCTCCCCCAGG - Intergenic
1145318931 17:21751646-21751668 GATCAAAGGCTGCCTCCCCCAGG + Intergenic
1145790230 17:27622034-27622056 CAGCAGAGGTGGCATCCCCTGGG - Exonic
1146265946 17:31452883-31452905 CAGCAGGGGCAACATCCCCCAGG - Intronic
1148865189 17:50624559-50624581 CAGCAGAGGGTCCAGCCCCCAGG - Intronic
1150555644 17:66251754-66251776 TACCAAAGACTGCATCTCCCTGG + Intronic
1151369742 17:73640310-73640332 ACCCAGAGGCTACATCCCGCTGG - Intronic
1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG + Intronic
1152114533 17:78377450-78377472 CCCCAGAGGCTGCAGCTCCATGG - Intergenic
1152922155 17:83071495-83071517 CAGCAGTGGCTGCAGCCACCAGG - Intergenic
1153249460 18:3106745-3106767 CACCACAGCCTCCATCTCCCAGG - Intronic
1154353409 18:13605987-13606009 CACCAGCAGCAGCATCCCCTGGG - Intronic
1155491559 18:26405993-26406015 AGCCGGAGGCTTCATCCCCCCGG - Intergenic
1157628245 18:49069963-49069985 CACCACAACCTGCACCCCCCGGG - Intronic
1158945592 18:62444526-62444548 CCCCAGAAGCTGCTTCTCCCTGG - Intergenic
1159015860 18:63101310-63101332 CACCTGAGGCTGCAGCTCCTGGG + Intergenic
1159383790 18:67696272-67696294 CACCACAGCCTCCATCTCCCGGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1160857549 19:1224218-1224240 CCCCACATGCTGCATCCTCCTGG - Intronic
1160960641 19:1719150-1719172 CACGCGAGGCTGCAGCCCCAGGG + Intergenic
1160976346 19:1794552-1794574 CACCCCAGGCTGCCTCCCCCTGG - Intronic
1161374711 19:3933512-3933534 CCCCAGGGGCCGCCTCCCCCGGG + Exonic
1161603748 19:5202748-5202770 CACCATTGGCTGCATCCCGCAGG + Intronic
1162138562 19:8571351-8571373 CTCCAAAGGCTCCATCCCTCAGG + Intronic
1163294829 19:16405309-16405331 CATCAGAGGCTGCACCCCACAGG + Intronic
1164534532 19:29075452-29075474 CAGCAGAGGCTGCAGCACCAAGG - Intergenic
1164538647 19:29105943-29105965 CTCCAGAGGCTCCCACCCCCTGG + Intergenic
1166140031 19:40800548-40800570 CAGCAGTGTCTTCATCCCCCGGG - Exonic
1167079875 19:47271437-47271459 CCCCAGAGGCTGCCCCCACCGGG + Exonic
1167486991 19:49768306-49768328 CTTCAGAGGCTGCATCCGCATGG + Intronic
926593511 2:14764387-14764409 CCCCAGAGGCAGCATTGCCCTGG + Intergenic
927152019 2:20201717-20201739 CTCCAGGGGCTGCTTCCTCCTGG - Exonic
927437642 2:23083989-23084011 CATCAGAGGCTGCATCCTTGGGG - Intergenic
928128208 2:28630468-28630490 CAGCACAGGCTGCAGGCCCCTGG + Intronic
929067998 2:37999685-37999707 CAGGAGAGTCTGCAACCCCCGGG + Intronic
931205268 2:60140317-60140339 CACCAGAGGCTGTACCCTTCAGG - Intergenic
931807465 2:65821389-65821411 GACCAGAGGCTGCATCCATGTGG - Intergenic
932674913 2:73771297-73771319 CACAAGAGGCTGCCTCTCCATGG + Intronic
933816556 2:86073374-86073396 CAGCAGAGCCTGCATGGCCCAGG + Intronic
934601883 2:95663997-95664019 CTCCAGTGGCTGCATTTCCCTGG + Intergenic
935753148 2:106256563-106256585 CACCACAGCCTCCATCTCCCAGG - Intergenic
940986631 2:160057894-160057916 CACCAGGGGGTGAATGCCCCAGG + Intronic
944605042 2:201345222-201345244 AAGCAGAGGCTGAATGCCCCTGG + Intronic
947872589 2:233447712-233447734 CAGCAGAGGCTGTTTCCACCTGG - Intronic
947905545 2:233759108-233759130 TACCAGAGGCTGTAACTCCCTGG - Intronic
947995731 2:234525618-234525640 CATCAGAGGCAGCCTCCCCAGGG + Intergenic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
948720596 2:239897793-239897815 CCCCAGAGACTGCAGCACCCAGG + Intronic
948839695 2:240642812-240642834 TCCCAGAGGCGGCAGCCCCCTGG - Intergenic
948871020 2:240798129-240798151 CACCAGCGCCTGCATCCACAGGG - Intronic
1168789691 20:567913-567935 CAGCAGAGGCAGCCTTCCCCAGG + Intergenic
1169140031 20:3222565-3222587 CACCAGAGGCTGCAAAAGCCTGG - Intronic
1171054854 20:21896390-21896412 CAGCTGAGGCTCGATCCCCCTGG - Intergenic
1171272254 20:23826245-23826267 CAGCATAGTCTCCATCCCCCGGG + Intronic
1172355436 20:34276641-34276663 GACTAGAGGCTGCTTCTCCCTGG - Intergenic
1172508110 20:35479181-35479203 GAGCAGAGGCTGGATTCCCCTGG - Intronic
1173248077 20:41349875-41349897 CACCTTAGGCAGCCTCCCCCAGG - Exonic
1173862331 20:46292197-46292219 CACTGGAGGCTCCCTCCCCCAGG + Intronic
1174215356 20:48912139-48912161 CACCTGAGGCTGAGTCCCCAGGG + Intergenic
1174393032 20:50229563-50229585 CGCCAGAGACTGCCTCCTCCAGG + Intergenic
1174872943 20:54200478-54200500 CACCAGAAGCTGCAACCCTGGGG - Intergenic
1175315669 20:58044915-58044937 CCCCTGAGGGTGCCTCCCCCAGG + Intergenic
1175641625 20:60635114-60635136 CACCTGAGGATGCTGCCCCCAGG - Intergenic
1176215977 20:63947942-63947964 CCCCAGAGGCTGCCCCTCCCAGG - Intronic
1176347284 21:5761188-5761210 AACCAGAGCCTGGATACCCCAGG + Intergenic
1176354098 21:5881772-5881794 AACCAGAGCCTGGATACCCCAGG + Intergenic
1176445052 21:6815025-6815047 CACCAGAGGACCCAGCCCCCTGG - Intergenic
1176497543 21:7563267-7563289 AACCAGAGCCTGGATACCCCAGG - Intergenic
1176541605 21:8159258-8159280 AACCAGAGCCTGGATACCCCAGG + Intergenic
1176560556 21:8342303-8342325 AACCAGAGCCTGGATACCCCAGG + Intergenic
1176823219 21:13680058-13680080 CACCAGAGGACCCAGCCCCCTGG - Intergenic
1177362673 21:20093740-20093762 CACCAATAGCTGCATCTCCCAGG - Intergenic
1177831571 21:26145116-26145138 CCCCAGAGACTTCATCCCACAGG - Intronic
1179433662 21:41344815-41344837 GACCACAGGCTGCACCCCCTTGG - Intronic
1179917044 21:44484565-44484587 CACCAAAGTCCGCATCTCCCAGG - Intergenic
1181754119 22:25010963-25010985 CACCACAAGCTGCATCTGCCTGG + Intronic
1182112138 22:27731389-27731411 CCCCAGAGCCTGGCTCCCCCTGG - Intergenic
1182676346 22:32042626-32042648 CTCCACAGCCTGCAGCCCCCAGG - Intergenic
1183723232 22:39574299-39574321 CAGCAGCGGCTGCAGCCACCGGG - Intronic
1184493505 22:44824103-44824125 CACCAGAGGCTGAGACCCACTGG + Intronic
1184691538 22:46119515-46119537 CACTGGAGGGTGCCTCCCCCCGG - Intergenic
1184791221 22:46701314-46701336 CTCCAGAGGCTGCTGCCCCGAGG - Intronic
1184835005 22:47015910-47015932 AAGCAGAGGCTGCATTCCCCAGG - Intronic
1185085342 22:48737838-48737860 CCTCAGAGGCTGCAGCTCCCTGG - Intronic
1185236430 22:49716237-49716259 CAGCAGAGACTGGATCCCACTGG + Intergenic
950829729 3:15860799-15860821 AACCAGAGGCTGGAGCCGCCCGG - Intergenic
951799575 3:26580651-26580673 CAGCAGATGCTCCATCCCACTGG - Intergenic
952854624 3:37759156-37759178 CATCAGAGGCTGCACACTCCAGG + Intronic
953274083 3:41477771-41477793 CAGAAGAGGCTGCATGCCCTTGG - Intronic
953419348 3:42742494-42742516 CACCAGGGGCCGCATCTCACTGG - Intronic
954447541 3:50554708-50554730 CAGCAGAGGCTGCAACATCCTGG + Intergenic
954769402 3:52952598-52952620 CACCAGATTCTGAATCCCCTGGG - Intronic
954812089 3:53254942-53254964 CACCAGGTGCTGTATCTCCCAGG - Intronic
954861545 3:53694835-53694857 CACCTGTGACTGCATCGCCCAGG - Intronic
954962781 3:54580789-54580811 CACCAGAGCCTGCTTCCCAGAGG + Intronic
955318237 3:57956576-57956598 CAGCAGAGGCTCCATCACCCTGG - Intergenic
957676783 3:83377533-83377555 CTTCAGAGGGTGCAACCCCCAGG - Intergenic
961066607 3:123882079-123882101 CATCAGGGGCTGCTTCCCCAGGG - Intronic
961532855 3:127550282-127550304 CAAGAGAGGCTGCATTCCCTGGG + Intergenic
961533109 3:127551992-127552014 CAGGAGAGGCTGCATTCCCTGGG + Intergenic
961833194 3:129635267-129635289 TACCAAAGGCTGCATCTCCCTGG - Intergenic
962477437 3:135767760-135767782 CACCAGAGGCTACATTTCCCTGG + Intergenic
962953462 3:140242809-140242831 CTCAAGAGGTTGCATCCCCTAGG + Intronic
962970033 3:140391448-140391470 CAGCAGAGGCTGAACTCCCCAGG + Intronic
964037282 3:152214880-152214902 CACCACAAGCTCCATCTCCCGGG - Intergenic
966907631 3:184539210-184539232 CATCACAGGCTGCCTCCCTCAGG + Intronic
968270827 3:197402456-197402478 CACCACAGACTCCTTCCCCCAGG + Intergenic
968289195 3:197525741-197525763 CACCAGAGTCTGCAGCCAGCAGG - Intronic
968522729 4:1041392-1041414 TAGCTGAGGCTGCACCCCCCGGG + Intergenic
969277800 4:6148750-6148772 CACCCGAGGCTGCAAGGCCCAGG + Intronic
969296880 4:6275531-6275553 CACCCCCGGGTGCATCCCCCAGG - Intronic
969398606 4:6938949-6938971 CAGCAGCGGCGCCATCCCCCAGG + Intronic
969600942 4:8176074-8176096 CCCCAGGAGCTGCATCCACCTGG - Intergenic
969718188 4:8878440-8878462 CACCAGAGCATCCATCCTCCAGG - Intergenic
969925534 4:10582201-10582223 TAGCAGAGGCTGGATCCTCCTGG - Intronic
971316395 4:25571706-25571728 CACCAGGGGCTGGAGACCCCAGG - Intergenic
972018736 4:34281207-34281229 CACCATTGCCTGCATCACCCTGG - Intergenic
972072466 4:35038554-35038576 CAGCTGAGGCTGCATGCTCCAGG + Intergenic
975656186 4:76643136-76643158 CACCACAAGCTCCATCTCCCAGG - Intronic
976709933 4:88059153-88059175 CACCAGAGGCTGTGTCTCCCCGG - Intronic
978233274 4:106426266-106426288 TCCCAGAGGCTACATCACCCTGG + Intergenic
981928601 4:150166416-150166438 CACCACAGCCTTCATCTCCCAGG - Intronic
985664536 5:1175227-1175249 CACCAGTGGCTGCAGGCTCCAGG - Intergenic
985712413 5:1436885-1436907 CACCAGAGGCTTCCTCCAGCGGG - Intronic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
986399962 5:7370908-7370930 CACCACAGCCTCCATCTCCCGGG - Intergenic
986706950 5:10460373-10460395 GACCAGAGGCTGCATGGCGCTGG - Intronic
993352268 5:86865344-86865366 CAACACAGCCTGCATCCCTCGGG + Intergenic
993424308 5:87743530-87743552 CACTGAAGGCTGCATCTCCCCGG - Intergenic
994552061 5:101247539-101247561 CACCAGACACTGGATCCACCAGG + Intergenic
996521960 5:124437199-124437221 CCCCAGAAGCTGCATCCTCAGGG - Intergenic
997966516 5:138361129-138361151 CAACAGGTGTTGCATCCCCCAGG - Intronic
998133855 5:139664482-139664504 CACCAGGCGCTGCATGGCCCTGG + Intronic
998469101 5:142369436-142369458 CACCAGAACCTGCGTCTCCCAGG - Intergenic
999937172 5:156500123-156500145 CACTGGGGGCTGTATCCCCCTGG + Intronic
1003868471 6:10383590-10383612 GCCCAGAGGCTGCACCACCCAGG + Intergenic
1004578788 6:16926922-16926944 CACCACAAGCTCCATCTCCCGGG + Intergenic
1004754953 6:18601149-18601171 CCCCAGAGGCTGCCTGCCCATGG + Intergenic
1006578965 6:35065644-35065666 CCCCAGGGGCTGCATCTTCCTGG - Intronic
1007244576 6:40451499-40451521 CAGAAGATGCTGCTTCCCCCAGG - Intronic
1007580365 6:42955509-42955531 CACCGCAGGCTCCGTCCCCCAGG + Intergenic
1007715745 6:43855082-43855104 CTCCAGAGGCTCCCTCCCCAGGG + Intergenic
1012444508 6:99294284-99294306 CTCCTGAGGGTGCATCCCGCTGG + Intronic
1014789212 6:125652734-125652756 CACCAAAGGCTTCATCTCCTTGG + Intergenic
1015624347 6:135164972-135164994 CTGCAGAGGCTGCATCACCTGGG - Intergenic
1017311797 6:152983763-152983785 GACCTGCGGCTGCATCTCCCAGG + Intergenic
1019156571 6:170043116-170043138 CACCAAAGGCTGCATCTTCCCGG + Intergenic
1021334060 7:19376445-19376467 CACTAGAGGCTGCATCTCCCAGG + Intergenic
1021459697 7:20872256-20872278 CACCACAGCCTCCATCTCCCAGG - Intergenic
1021484033 7:21147297-21147319 CACTAGAGGCTTCATCCCAGAGG - Intergenic
1021511059 7:21432916-21432938 CACCGCAGCCTGGATCCCCCGGG - Intronic
1022792342 7:33701572-33701594 AGCCAGAGGATGCATCCCACAGG + Intergenic
1022806102 7:33824121-33824143 CTCCTGAGGCTGCATCATCCAGG + Intergenic
1023657090 7:42434619-42434641 CACCACAAGCTCCATCTCCCGGG + Intergenic
1023871990 7:44268309-44268331 GAGCAGAGGCTGCAGCCACCAGG - Intronic
1024627102 7:51217415-51217437 CACCACAGTCTCCATCTCCCGGG + Intronic
1025257963 7:57398510-57398532 CAAGAGAGGCTGCATCCAACAGG + Intergenic
1029644393 7:101844223-101844245 CACGGAAGGCTGCATCTCCCTGG + Intronic
1030808467 7:113945706-113945728 CACCATTGCCTGCATCACCCTGG + Intronic
1033411162 7:141119135-141119157 CACCTGGGGCTCCATCCCACTGG + Intronic
1034935224 7:155194936-155194958 CCAGAGAGGCTTCATCCCCCTGG + Intergenic
1035250995 7:157596731-157596753 CACAAGCGGCTGCCTCCCCAAGG - Intronic
1035355281 7:158272916-158272938 CAGCAGAGTCTGCATGCACCGGG - Intronic
1036690699 8:10943030-10943052 GACCATAGGCTGCATGGCCCAGG + Intronic
1036691779 8:10948961-10948983 CCCGAGAGGCTGCACCGCCCAGG - Intronic
1037497570 8:19454593-19454615 CACCACAGCCTCCATCTCCCAGG - Intronic
1038612713 8:29070210-29070232 CACCAGGCGCTGCACCACCCAGG + Exonic
1040529355 8:48253901-48253923 CACCTAAGGCTGCACCCACCTGG - Intergenic
1041514341 8:58683906-58683928 CACCAAAGGCTGTGTCTCCCTGG + Intergenic
1041661913 8:60409196-60409218 CACAAGAGGCTGCATCACTGAGG - Intergenic
1049248156 8:141573867-141573889 CAGCAGAGCCGGCAGCCCCCGGG + Intergenic
1049297057 8:141846871-141846893 TACCAGAGGCTGGAGGCCCCAGG + Intergenic
1049532402 8:143160841-143160863 CACCAGAAGCCGCAGCCCCAGGG + Intergenic
1049849468 8:144823090-144823112 TTCCTGAGGCTGCCTCCCCCTGG + Intergenic
1052859541 9:33428501-33428523 CACCAGAGGCTATTTCTCCCTGG - Intergenic
1053306736 9:36989700-36989722 CCCCAGAGTCTCCATCCTCCAGG - Intronic
1053351460 9:37416110-37416132 CACCAGCAGCAGCATCACCCGGG + Intergenic
1054451116 9:65404074-65404096 CAGCAGAGGCTTCACCTCCCTGG - Intergenic
1055397919 9:75892689-75892711 CTCCAGGTGCCGCATCCCCCAGG - Intronic
1057222526 9:93264935-93264957 CCCCTTGGGCTGCATCCCCCTGG + Intronic
1057225125 9:93289130-93289152 CTCCAGAGGCTGCCTCAACCAGG + Exonic
1057552874 9:96064961-96064983 AAGCAGAGGCTCCATGCCCCAGG + Intergenic
1058242047 9:102576387-102576409 CACCAAAGGCTGCATCTCCCTGG - Intergenic
1060336026 9:122724016-122724038 CACCTCAGGCTTCATCCTCCTGG + Exonic
1060338376 9:122749874-122749896 CACCTCAGGCTTCATCCTCCTGG + Exonic
1060964250 9:127703730-127703752 TACCAGTGGCTGCCACCCCCTGG - Intronic
1061486089 9:130921144-130921166 CACCAGAGCCTGCTTCCCGGAGG - Intronic
1061733679 9:132637178-132637200 CAGCAGAGGCTCCATCTCCCTGG + Intronic
1061839218 9:133347939-133347961 CACCAGACGCCGCGTCCGCCGGG + Intronic
1061873082 9:133531032-133531054 CACCAGTGGCTGCCCGCCCCTGG + Intergenic
1062092901 9:134687889-134687911 CACCAGAGGGTGGATCCCAGTGG - Intronic
1062339630 9:136088213-136088235 CCCCAGAGGCTCCGTCCCACTGG - Intronic
1062397892 9:136359874-136359896 CCCCAGAAGCAGCAGCCCCCAGG + Intronic
1062528248 9:136987232-136987254 CCCCAGAGGCTGCCCCACCCTGG - Intergenic
1062551646 9:137090187-137090209 CACCAGAGTCAGCACCACCCTGG - Intronic
1062720844 9:138043233-138043255 GAGCAGAGGCTGGGTCCCCCTGG + Intronic
1203524143 Un_GL000213v1:69500-69522 CACCAGAGGACCCAGCCCCCTGG + Intergenic
1203462878 Un_GL000220v1:58739-58761 AACCAGAGCCTGGATACCCCAGG + Intergenic
1186110109 X:6246596-6246618 CACAAGAGGCTTCCTCTCCCAGG + Intergenic
1186891738 X:13965752-13965774 GGACAGAAGCTGCATCCCCCGGG - Intergenic
1189500957 X:41558133-41558155 CACCTGCATCTGCATCCCCCAGG - Intronic
1192142774 X:68659688-68659710 CAGCAGCAGCTGCAACCCCCAGG - Intronic
1195304112 X:103562346-103562368 CAGCAGAGGCTCCATCCACAGGG + Intergenic
1195375234 X:104220344-104220366 TACCAAAGGCTGCATCTCCCTGG - Intergenic
1197262619 X:124334056-124334078 CACCAGGGTGTGCATCCTCCGGG - Intronic
1197603776 X:128560928-128560950 CACCACAGCCTGCAACACCCTGG + Intergenic
1197709189 X:129653964-129653986 GAGCAGAGGCAGCCTCCCCCAGG - Intronic
1197893322 X:131286665-131286687 CACCAGAGGCCCCATGACCCTGG - Exonic
1199143401 X:144336380-144336402 TTCCAGAGGCTTCTTCCCCCAGG + Intergenic
1199373762 X:147083391-147083413 CTTCAGAGGCTGCAAGCCCCAGG + Intergenic
1200156125 X:153976453-153976475 CACCACAGCCTGCGTCTCCCAGG - Intronic
1201486157 Y:14496551-14496573 CACAAGAGGCTGCCTGTCCCAGG - Intergenic