ID: 1122789038

View in Genome Browser
Species Human (GRCh38)
Location 14:104176690-104176712
Sequence CTCGGATCCCACCGCTGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122789030_1122789038 7 Left 1122789030 14:104176660-104176682 CCAGGGCGGCCCGCAGGCCAGAG 0: 1
1: 0
2: 1
3: 24
4: 254
Right 1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG 0: 1
1: 0
2: 2
3: 7
4: 54
1122789036_1122789038 -10 Left 1122789036 14:104176677-104176699 CCAGAGGCTGTGGCTCGGATCCC 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG 0: 1
1: 0
2: 2
3: 7
4: 54
1122789033_1122789038 -2 Left 1122789033 14:104176669-104176691 CCCGCAGGCCAGAGGCTGTGGCT 0: 1
1: 0
2: 7
3: 92
4: 773
Right 1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG 0: 1
1: 0
2: 2
3: 7
4: 54
1122789034_1122789038 -3 Left 1122789034 14:104176670-104176692 CCGCAGGCCAGAGGCTGTGGCTC 0: 1
1: 1
2: 15
3: 272
4: 1569
Right 1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG 0: 1
1: 0
2: 2
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122789038 Original CRISPR CTCGGATCCCACCGCTGCGG AGG Exonic
907244854 1:53102289-53102311 CCCAGAGCCCACCGCTGCCGTGG - Intronic
915637032 1:157194781-157194803 CCCGCACCCCACCGCAGCGGGGG - Intergenic
915734248 1:158074758-158074780 CTAGGATCCCACTTCTGTGGTGG + Intronic
920214171 1:204350479-204350501 CTCTGAGCCCAGCCCTGCGGAGG - Intronic
922335642 1:224616529-224616551 CTCGGAGCGCACGGCTGCGCTGG + Exonic
923042920 1:230332767-230332789 GGCCGAGCCCACCGCTGCGGTGG - Intronic
1064370664 10:14749623-14749645 CTCGGTTCCCATCTCTGCGAAGG - Intronic
1067008833 10:42691163-42691185 CTTGGAGGCCACCGCTGTGGCGG + Intergenic
1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG + Intronic
1071534383 10:86415825-86415847 CTCGGAACCCCCAGCTGCTGTGG + Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1075093558 10:119456698-119456720 CTGGGAGCCCACCCCTGCTGTGG + Intronic
1077219109 11:1407545-1407567 CTCAGACCCCACCTCTGCAGGGG + Intronic
1077303490 11:1857556-1857578 CTGAGATCCCACTGCTGGGGCGG + Intronic
1078659827 11:13277865-13277887 CTCGGATCCCGCGGCGGCGGCGG - Exonic
1094048609 12:26195484-26195506 CTCGAATCCCCCCTCTGCTGCGG + Exonic
1096127689 12:49131517-49131539 CTCGGAGCCCGCCTCTGCGGCGG - Intergenic
1107605007 13:42048554-42048576 CTCGGTTCCCGCCGGAGCGGCGG - Intronic
1110119775 13:71866580-71866602 CCCGGAGCCCATCGCTTCGGCGG - Exonic
1120941700 14:89955922-89955944 CTCGGATCCCGCCCCTTCGGCGG - Intronic
1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG + Exonic
1122985554 14:105210033-105210055 CTCAGCTCCCACGGCTGCGCCGG + Exonic
1132690899 16:1181366-1181388 CTCAGCTCCCACCGTTGCCGGGG - Intronic
1133162320 16:3920367-3920389 CAGGGATCCCACCGCCACGGTGG + Intergenic
1135419607 16:22297202-22297224 TTCGAATCCCACCGCTGCCAGGG + Intergenic
1139375333 16:66493308-66493330 CTCGGACCCCACCCCTTCTGAGG - Intronic
1147179479 17:38675034-38675056 CCCGGACCCCACCCCTCCGGCGG + Exonic
1152543995 17:80991828-80991850 CTCGGGTCCTCCCGCTACGGCGG - Exonic
1158190964 18:54828433-54828455 CTCGGAGTCCGCCGCGGCGGCGG - Exonic
1160172455 18:76566527-76566549 CTCGGATCCCACCTCTCCGGAGG + Intergenic
1160474043 18:79166849-79166871 CCCGGATCCCACGCCTGCCGAGG + Intronic
1162325501 19:9996644-9996666 CTCGGATCCCATCAATGCCGGGG + Exonic
1164528136 19:29026759-29026781 CTGTGTTCCCACCCCTGCGGTGG - Intergenic
1166871576 19:45873988-45874010 CTCTGGCCCCACTGCTGCGGGGG - Intergenic
1168102565 19:54148812-54148834 TTCAGAACCCACCGATGCGGGGG - Intronic
926141468 2:10370944-10370966 CTCGGATCCCACAGGTGAAGGGG - Intronic
927183781 2:20467724-20467746 CTCTGAGCCCACAGCTGCAGAGG - Intergenic
928278076 2:29920594-29920616 CCCGGAGCCCACAGCTGCCGTGG + Exonic
940774911 2:157875796-157875818 CTCGGGTCCCGCCGCGGCCGGGG + Intronic
940956818 2:159738021-159738043 CTCGGATCCCACGCCTGCCAAGG + Intronic
1174503278 20:51000941-51000963 CTCAGATCCCACCTCTGAGCAGG - Intergenic
1175891362 20:62317443-62317465 CTCGGACCCCACTGCTGCAGAGG - Exonic
1181634363 22:24167551-24167573 CGCTGCTCCCACCGCTGCGCTGG + Intronic
1184002944 22:41688629-41688651 CTGGGACCCCGCCGCTGCTGGGG + Intronic
1185000346 22:48241753-48241775 CCCGGGTCCCAGGGCTGCGGGGG - Intergenic
954878365 3:53817977-53817999 CTCCGATCCCACTGCCGTGGTGG - Exonic
967221296 3:187250189-187250211 CTCGGATCCCGCCAGTGCTGGGG + Intronic
969224188 4:5783909-5783931 CTCTCATCCCACCCCTGTGGTGG - Intronic
974226532 4:59052576-59052598 CTCAGATCCCTCCTCTGTGGAGG - Intergenic
998419379 5:141969450-141969472 CTCTGATCCCAGCGTTGGGGCGG + Intronic
1013237057 6:108206579-108206601 CTCGAATCCCACTGGTGCGGTGG + Intergenic
1016416941 6:143843201-143843223 CTCGGCTCCCACCCCTGGGCGGG - Intronic
1020252748 7:6483334-6483356 CCAGGATCACACCGCTGGGGAGG - Intronic
1023999216 7:45179935-45179957 CTCGGTTTCCAGGGCTGCGGTGG - Intronic
1033237407 7:139649229-139649251 CTCGGTGACCACTGCTGCGGCGG + Intronic
1036739465 8:11347734-11347756 CTCGGCTCCCACCTCCGCGGGGG - Intergenic
1038304094 8:26383483-26383505 CGCGGATCCCCCTGGTGCGGGGG + Intronic
1039586733 8:38713210-38713232 CTCTGATTCCTCCGTTGCGGGGG + Intergenic
1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG + Intronic
1049793602 8:144485101-144485123 CTCTGGTCCCACCTCTGAGGGGG - Intronic
1054870425 9:70043740-70043762 CTCGGGTCCCAACCCAGCGGAGG + Exonic
1057489273 9:95508879-95508901 CTCGGACCCCGCGGCGGCGGCGG - Intronic
1062268875 9:135699785-135699807 CTCGGTTCCCACTTATGCGGTGG + Intergenic
1062400757 9:136371665-136371687 CGGGGCTCCCACCGCAGCGGGGG - Intronic