ID: 1122789112

View in Genome Browser
Species Human (GRCh38)
Location 14:104176928-104176950
Sequence CCGGGTTCACAGCATGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122789112_1122789124 9 Left 1122789112 14:104176928-104176950 CCCTCCGCATGCTGTGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1122789124 14:104176960-104176982 GGGCTGCTGCTGTCCTTCGAGGG 0: 1
1: 0
2: 0
3: 20
4: 159
1122789112_1122789125 10 Left 1122789112 14:104176928-104176950 CCCTCCGCATGCTGTGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1122789125 14:104176961-104176983 GGCTGCTGCTGTCCTTCGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 173
1122789112_1122789126 13 Left 1122789112 14:104176928-104176950 CCCTCCGCATGCTGTGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1122789126 14:104176964-104176986 TGCTGCTGTCCTTCGAGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1122789112_1122789123 8 Left 1122789112 14:104176928-104176950 CCCTCCGCATGCTGTGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1122789123 14:104176959-104176981 GGGGCTGCTGCTGTCCTTCGAGG 0: 1
1: 0
2: 2
3: 28
4: 266
1122789112_1122789127 16 Left 1122789112 14:104176928-104176950 CCCTCCGCATGCTGTGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1122789127 14:104176967-104176989 TGCTGTCCTTCGAGGGGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122789112 Original CRISPR CCGGGTTCACAGCATGCGGA GGG (reversed) Exonic
908152480 1:61316585-61316607 CAGGGTTATCAGCATTCGGAGGG - Intronic
909039111 1:70628861-70628883 CTGGGTTCACACCATGAAGAAGG + Intergenic
1063299489 10:4838919-4838941 CCAGGAACACAGGATGCGGAAGG + Intronic
1068602044 10:58966773-58966795 CAGGGATCACAGAATCCGGAGGG + Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1076340951 10:129744539-129744561 TGGGGTTCACAGCAGGGGGAAGG - Intronic
1081546232 11:44073811-44073833 CTGGGTTTAAAGCATGGGGAGGG + Intronic
1084486216 11:69449786-69449808 CCGGGTCCACTGCCTGGGGATGG + Intergenic
1086405799 11:86498017-86498039 CCCTGTACACGGCATGCGGAGGG - Exonic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1101339124 12:103825877-103825899 CCCGGTGCACAGCATGTGGATGG - Intronic
1110195280 13:72781710-72781732 CCGGGTGCGCAGCGTGTGGAGGG - Exonic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113448105 13:110385948-110385970 CCGTGGTCACAGCGTGTGGATGG + Intronic
1113448110 13:110385972-110385994 CCGTGGTCACAGCGTGTGGATGG + Intronic
1113448115 13:110385996-110386018 CCGTGGTCACAGCGTGTGGATGG + Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1120455075 14:84719601-84719623 CCAGGTTCTCAACATGGGGATGG - Intergenic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1123003975 14:105312575-105312597 CCAGGGTCATAGCATGGGGAGGG + Exonic
1130749210 15:86692082-86692104 CCGGGTTCACACCATTCCAAAGG - Intronic
1136297773 16:29313443-29313465 CCGGGATCTCAGCGTGCGGGGGG + Intergenic
1136297782 16:29313469-29313491 CCGGGATCTCAGCGTGCGGGGGG + Intergenic
1136508688 16:30722726-30722748 CCTGGTTAGCAGCAAGCGGAAGG - Exonic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142059334 16:88019548-88019570 CCGGGATCTCAGCGTGCGGGGGG + Intronic
1142059369 16:88019659-88019681 CCGGGATCTCAGCGTGCGGGGGG + Intronic
1142059380 16:88019690-88019712 CCGGGATCTCAGCGTGCGGGGGG + Intronic
1142623523 17:1179340-1179362 CCGGGTTCACAACAGGTGGGAGG + Intronic
1143028923 17:3956649-3956671 CCTGGGTCACAGAATGAGGAAGG + Intronic
1144177404 17:12720336-12720358 CCGCTTTCTCAGCATGTGGAAGG + Intronic
1152041016 17:77903017-77903039 CCGGATTCACAGAATGCAGGCGG + Intergenic
1152686209 17:81695017-81695039 CCGGCTGCACAGCCTGGGGAAGG + Exonic
1154241310 18:12657117-12657139 CCGGGTTCACGGGGTGGGGAGGG - Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
926127898 2:10283147-10283169 AAGGGTTCCCAGCATGGGGATGG + Intergenic
931246960 2:60499769-60499791 CCTGGGCCACAGCATGTGGAAGG + Intronic
934614234 2:95761442-95761464 CTGTGTTCAAAGCATCCGGAAGG + Intergenic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
937977026 2:127588645-127588667 CTGGGTCCACAGCATGCAGTTGG + Intronic
946417299 2:219546519-219546541 CTGGGATCACAGTATGGGGAGGG - Intronic
948443736 2:238015931-238015953 GGGGGTACACAGCATGTGGATGG + Intronic
1170666774 20:18393350-18393372 CCTGGTGCCCAGCATGAGGATGG - Intronic
1179960864 21:44766415-44766437 CTGGGTTCACAGCCTTCAGAGGG + Intergenic
1180136845 21:45867481-45867503 CCGCATTCACCGCACGCGGAGGG + Intronic
1181033135 22:20157735-20157757 CCGGGTTCCCAGCGTGCAGGAGG + Intergenic
1183742269 22:39675380-39675402 CAGGGGTCAGAGCATGGGGAAGG - Intronic
1185151895 22:49168534-49168556 CGTGGTTCAGAGCATGCGGGTGG - Intergenic
968315102 3:197717348-197717370 CCGGGTTCACAGCATTCTCCTGG - Intronic
969183411 4:5458743-5458765 CTGGGTGCACAGCTTTCGGAGGG + Intronic
969456016 4:7300077-7300099 CCCGGTCCTCAGCAGGCGGAGGG - Intronic
969588954 4:8110393-8110415 CTGAGGTCACAGCATGCAGAAGG - Intronic
975745702 4:77472374-77472396 CCGAGTTCACTGCATGGGAAAGG - Intergenic
1013823264 6:114180601-114180623 CCGGCTTCTCAGCCTGCAGACGG + Intronic
1016325758 6:142899255-142899277 CCTGGTTGACAGCATGGGAAAGG - Intronic
1019723575 7:2587935-2587957 ACGGGCTCACAGGGTGCGGAAGG + Intronic
1021585559 7:22203736-22203758 CCTGGTCCACAGCATGCAGGTGG - Intronic
1026053285 7:66964619-66964641 CCTGGGTCACAGCATGGTGAAGG + Intergenic
1028987840 7:97021894-97021916 GCGGGTTGAAAGCAAGCGGAGGG - Intronic
1035357245 7:158283590-158283612 CCGGGGTCACAGCATGTCCACGG + Intronic
1062629603 9:137457952-137457974 CCGGTTTCATAGCAGGCCGAAGG + Intronic