ID: 1122789201

View in Genome Browser
Species Human (GRCh38)
Location 14:104177253-104177275
Sequence GGGGCCCCCAAGCCCCCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122789193_1122789201 9 Left 1122789193 14:104177221-104177243 CCGCCTGTAGGAGCGGCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789186_1122789201 29 Left 1122789186 14:104177201-104177223 CCCCACACACGGTCCAGCTCCCG 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789194_1122789201 6 Left 1122789194 14:104177224-104177246 CCTGTAGGAGCGGCGCAGCCAAG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789188_1122789201 27 Left 1122789188 14:104177203-104177225 CCACACACGGTCCAGCTCCCGCC 0: 1
1: 0
2: 1
3: 18
4: 174
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789190_1122789201 16 Left 1122789190 14:104177214-104177236 CCAGCTCCCGCCTGTAGGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789187_1122789201 28 Left 1122789187 14:104177202-104177224 CCCACACACGGTCCAGCTCCCGC 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255
1122789192_1122789201 10 Left 1122789192 14:104177220-104177242 CCCGCCTGTAGGAGCGGCGCAGC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122789201 Original CRISPR GGGGCCCCCAAGCCCCCTGT TGG Exonic
900507967 1:3039097-3039119 GTGGTCCACAAGGCCCCTGTCGG - Intergenic
901173954 1:7285020-7285042 GAGGCCACCAAGCACCCTGTGGG - Intronic
901526263 1:9824773-9824795 GAGGACCCCAAGATCCCTGTAGG - Intergenic
901828782 1:11879663-11879685 GGGGCCCCCTGGGCCCCTGGAGG + Intergenic
902255926 1:15188528-15188550 GGGCCCCCAAAGACCCTTGTTGG + Intronic
903534862 1:24060234-24060256 GGCGCCCCTCAGCCCCCTGCAGG + Intronic
903647265 1:24902881-24902903 GGGGCTCCCATGGCCCCTCTTGG - Intronic
903966419 1:27093218-27093240 GGGGTCCCCAAGACCCTTGCAGG + Intergenic
904286066 1:29453964-29453986 GGTCCCTCCAAGACCCCTGTGGG + Intergenic
904676296 1:32201114-32201136 GCGCCCCCCAAGCCTCCGGTCGG - Intronic
904756760 1:32772252-32772274 GTGGCCCGCAAGCCGTCTGTGGG + Exonic
906461075 1:46035405-46035427 TGGGCTCCCGAGCCTCCTGTGGG - Exonic
907290271 1:53408799-53408821 GGGGTCCCCTAGCCCCCTCATGG - Intergenic
907290280 1:53408820-53408842 GGGGCCACCTAGCCCCCTCGTGG - Intergenic
907734971 1:57103649-57103671 TTGGCCCCCCAGCACCCTGTAGG + Intronic
909005459 1:70270745-70270767 GGGGTCCCCAACACCTCTGTTGG - Intronic
909039130 1:70628913-70628935 GGGGCCCCCTTTCCTCCTGTGGG - Intergenic
909384042 1:75035541-75035563 AGGCCCCCTAAGCCCCATGTGGG - Intergenic
910289783 1:85588862-85588884 TGGGGCCCCAAGACCCCTCTTGG - Intergenic
913319423 1:117577964-117577986 CAGGACACCAAGCCCCCTGTGGG + Intergenic
913938376 1:125078702-125078724 GGGGACCCCAAGTCCCCCTTTGG + Intergenic
913944457 1:125145351-125145373 GGGGTCCCCAAGTCCCCCTTCGG - Intergenic
913954722 1:143278422-143278444 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
913982715 1:143536943-143536965 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
915080858 1:153350870-153350892 GGGGACCCCAAGACCCCTTGGGG + Intergenic
918311188 1:183286661-183286683 GTGGCCACCAAGCCCACTGCAGG - Exonic
918388688 1:184036789-184036811 GTGTCCCCCATGCCCCTTGTGGG + Intronic
920065496 1:203266714-203266736 GGGGCCCCCCACCCCCCAGACGG + Intronic
922183645 1:223255838-223255860 TGGGCCCTCAAGCTCCCTGCAGG - Intronic
922726125 1:227923843-227923865 GGGGCCCCCACGGTCCCTGTGGG - Intronic
1062871426 10:908289-908311 GGGGCTCCCATGCCCTCTTTGGG - Intronic
1063959547 10:11295847-11295869 GGGGCCCTCAAAACCCCTCTGGG - Intronic
1064978412 10:21142663-21142685 GGGGCCCCCAACCCCCAGGGCGG + Intronic
1066950004 10:42108177-42108199 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
1067082595 10:43219959-43219981 GGGGGCACCCAGCCCCCTGCTGG + Intronic
1067768601 10:49108029-49108051 AGGGCCCCAAGTCCCCCTGTGGG + Intronic
1069840807 10:71338145-71338167 GAGGCCCCCATGCCCACTCTGGG + Intronic
1069888649 10:71639333-71639355 GCAGTCCCCCAGCCCCCTGTGGG + Intronic
1071288928 10:84174093-84174115 GGAACCCCCAAGCCACCTGCAGG - Intronic
1073257212 10:102160562-102160584 GCAGCCCCCAAGCAACCTGTGGG + Exonic
1075800756 10:125152062-125152084 GGGGCCGCCAAGTGCCCTGCGGG + Intronic
1075892928 10:125970210-125970232 GGGGCCCCCCACCCCCCAGAGGG + Intronic
1076048250 10:127312361-127312383 GGGGCCCTCAATGCCCCTCTGGG + Intronic
1076405084 10:130206406-130206428 GGGGCCCTCAAGGCCCACGTGGG + Intergenic
1076675144 10:132143814-132143836 GGGGGCCCACAGCCCTCTGTGGG + Intronic
1076792296 10:132784093-132784115 GGGTCCCCCGAGCCCCCGGCTGG + Intergenic
1076848677 10:133082415-133082437 GGGGCCCCCACAGCTCCTGTTGG - Intronic
1076872124 10:133199316-133199338 GGCGGCCCCGAGTCCCCTGTGGG - Intronic
1076875591 10:133214146-133214168 GTGGGCCCCACGCCCCGTGTTGG - Intronic
1077051582 11:569040-569062 GGGGACCCCAAGCCGCCCGGGGG - Intergenic
1077182599 11:1223341-1223363 GGGGCCCCAGAGCCCTGTGTTGG - Intronic
1077185449 11:1233622-1233644 GGAGCCCCCAAATCCCCTGGAGG - Intronic
1077332432 11:1989435-1989457 GGTGCCCCCAAGCCCTCAGAAGG + Intergenic
1077547587 11:3182200-3182222 GGGGGCCCCAAGCTCTCTGAAGG + Intergenic
1077623023 11:3744508-3744530 GGAGCCCCCCAGGCCCCAGTAGG - Exonic
1078259738 11:9694341-9694363 TGGGCCCAAAAGCCCCCTGTTGG + Intronic
1081531116 11:43959941-43959963 GGGGGTCCCAAGCCTCCTGTGGG - Intergenic
1082014034 11:47471045-47471067 GGGGCCTGCCAGACCCCTGTGGG + Intronic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1084604837 11:70166443-70166465 GGTGCCCCCAAGCCCGATGCTGG + Intronic
1085456184 11:76666546-76666568 GGGGCAGCCAGGCCTCCTGTGGG - Intronic
1089619241 11:119713112-119713134 GGGGCATCCAAGCAGCCTGTGGG + Intronic
1091167610 11:133493272-133493294 GGGGCCACCCAGCACCCTTTGGG + Intronic
1202815413 11_KI270721v1_random:44611-44633 GGTGCCCCCAAGCCCTCAGAAGG + Intergenic
1096406632 12:51348539-51348561 GAGGCCCTCAAGCCTCCTCTTGG - Intergenic
1101427782 12:104601949-104601971 GGGGTCCCGAAGCCCCCTGCAGG + Exonic
1103980563 12:124734421-124734443 GGGGCTCCCACGCCCCCCGCAGG - Intergenic
1104216117 12:126735629-126735651 GGGGCTCCCATGACCCTTGTAGG - Intergenic
1104846834 12:131851175-131851197 GGGGGCCCCAGGCCCACTGGTGG + Exonic
1104953048 12:132451055-132451077 GAGGCCCCCAAGGCCCGTTTGGG + Intergenic
1113790027 13:113023361-113023383 GGGCCCCCGAGGCTCCCTGTGGG - Intronic
1114451367 14:22828256-22828278 GGGGCCCCCAGGTCACATGTAGG + Intronic
1117489171 14:56228953-56228975 GGGACCCCCAAGCCAGGTGTGGG - Intronic
1118835589 14:69475679-69475701 GGGTCCCCCGGGGCCCCTGTGGG - Intergenic
1122144705 14:99682812-99682834 GGAGCCACCAGGTCCCCTGTGGG - Intergenic
1122419304 14:101565051-101565073 GGGACCCCCAAGCCACCGGTAGG - Intergenic
1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG + Exonic
1123944489 15:25232499-25232521 TGGGTCCCGAAGCCCCCTGCAGG + Intergenic
1124254845 15:28132029-28132051 CGGGCCCCCAGGGCCCCTCTGGG - Intronic
1125518982 15:40337878-40337900 AGGGCTCCCAAGAACCCTGTAGG + Exonic
1125921623 15:43528716-43528738 GGGCCCCCGGAGCCCCCTGCAGG - Exonic
1128322570 15:66703519-66703541 GGGCCCCCCGAGGCCCATGTCGG + Exonic
1132473114 16:117931-117953 GGGGCCCCAACTCCCCCTGGTGG - Intronic
1132658417 16:1051058-1051080 GGGGCCCCGAAGCCCGGTGTCGG + Intergenic
1132693516 16:1192178-1192200 GGGGCACCCAGGCCCCCTCCTGG + Intronic
1134053966 16:11157572-11157594 GGGCCCCCCAAGGCTCCTGCAGG + Intronic
1136551348 16:30984132-30984154 GGGGCCCCCAACCCCACGCTTGG - Exonic
1136886402 16:33932758-33932780 GGGACCCCCAAGACCCCAGAAGG + Intergenic
1136935400 16:34458681-34458703 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
1136938236 16:34496316-34496338 GGGGTCCCCAAGTCCCCCTTCGG + Intergenic
1136961582 16:34852241-34852263 GGGGTCCCCAAGTCCCCCTTCGG - Intergenic
1136964418 16:34889889-34889911 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1137093558 16:36224355-36224377 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1137540318 16:49357221-49357243 GGGCTCCCAAAGCCCCCTGCCGG + Intergenic
1141469493 16:84228781-84228803 GGTGCCCACAATCGCCCTGTGGG - Intronic
1141551667 16:84810506-84810528 TGGGTCCCCAGGTCCCCTGTTGG - Intergenic
1141866247 16:86752030-86752052 GCGGCCTCCAAACCCCCTTTTGG + Intergenic
1141988261 16:87594045-87594067 GGGCAACCCAAGCCCCCTGCAGG + Intergenic
1142429038 16:90016554-90016576 GGGGGACCCAACCCCCCTGCAGG + Intronic
1142474448 17:180962-180984 GGGGCCCGCAAGCCCGCGGCGGG + Intronic
1142563996 17:827736-827758 GGGACCCTCAAGCCCCCAGCAGG - Intronic
1143670940 17:8395525-8395547 GGGGTCTCCAAGTCCCCTTTGGG - Intronic
1145997825 17:29114677-29114699 GGGGCCCTCAATGCACCTGTAGG + Intronic
1147139412 17:38452943-38452965 GGAGTCCCCAACACCCCTGTGGG - Intronic
1147143653 17:38473284-38473306 GGGACCCCCAAGACCCCAGAAGG - Intronic
1148109635 17:45137241-45137263 AGGGCCCCCAAGCCCCCGAGAGG + Intronic
1148442910 17:47721035-47721057 GGGGCCCTCTAGCCCCCCGAGGG - Intergenic
1150267844 17:63842514-63842536 GGGCCCCCCACGCCTCCTGCCGG + Exonic
1151206508 17:72512115-72512137 GGTGCTCCCAAGCCACCTCTGGG - Intergenic
1151216996 17:72583793-72583815 TGAGCCCCCAAGGCTCCTGTCGG - Intergenic
1151325861 17:73379469-73379491 GGGGCCCTCCAGCCCCCCGCAGG - Exonic
1151334853 17:73433914-73433936 GGGGCCTCCAAGCCCACCGAGGG + Intronic
1152784609 17:82241282-82241304 GGGGCCACCAAGCCCTTTCTGGG - Intronic
1203184124 17_KI270729v1_random:95904-95926 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1154001135 18:10483312-10483334 TGTGCCCCTAAGCCCTCTGTAGG + Intronic
1154325365 18:13387217-13387239 GGAGCCCCCATGCCCACAGTGGG + Intronic
1154515633 18:15162246-15162268 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
1160594562 18:79964746-79964768 GGGGCCCTGAAGCCCCCGGCGGG + Exonic
1160679881 19:407771-407793 GGGGCCCCCATCACCCCCGTTGG + Exonic
1161086952 19:2339758-2339780 TGGGCTCCCGAGCCCCGTGTCGG + Intronic
1161975933 19:7607749-7607771 TGGGCCCCCAAGCCCACCTTGGG - Intronic
1162402403 19:10454095-10454117 GGGGCCTCCAAGCCCGGTTTTGG + Intronic
1162654408 19:12117676-12117698 CGGGACCCCAGGCCCCCTGCAGG + Intronic
1163603784 19:18263572-18263594 GGGGGCCCCAAGTCCCTTGCAGG - Intronic
1163801220 19:19367026-19367048 TGGGCCACCATGCCCCCTGGTGG - Intergenic
1163872020 19:19830139-19830161 GGGGCTCCCCAGGCCCATGTGGG - Intergenic
1163968277 19:20769053-20769075 GGGGCTCCCCAGGCCCATGTGGG - Intronic
1165154015 19:33776820-33776842 GGGGCTCCCAAGCCCCAGGAGGG - Intergenic
1166750868 19:45163467-45163489 GGGGCCCCCGGGGCCCCCGTGGG - Intronic
1167721196 19:51181707-51181729 GAGGCCCCCGAGCCCCTTGTGGG - Intergenic
1168348073 19:55660446-55660468 GGGGCTCGCAGGCCCACTGTTGG + Intronic
1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG + Intergenic
1168665516 19:58202020-58202042 AGTGCCCCTAAGCTCCCTGTTGG - Intronic
925912130 2:8580974-8580996 GAAGCCCTCAAGCCCCATGTCGG - Intergenic
933629428 2:84639126-84639148 GGGTCCCCCATACCCACTGTGGG + Intronic
935279692 2:101506625-101506647 GGGGCCCCCAGGCCCTCCGATGG + Intergenic
935695658 2:105768847-105768869 GGAGTCCCCATGCCCCCTGGGGG + Intronic
936039974 2:109142376-109142398 AGGACCCCAAAGCACCCTGTGGG + Intronic
936084313 2:109456085-109456107 GAGGTTCCCAAGCCCCCAGTGGG - Intronic
937922172 2:127138262-127138284 GGTGCCCCCAGGGCCACTGTGGG - Intergenic
938515894 2:132007030-132007052 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
940817218 2:158310508-158310530 GGGGCCCCCCACCCCCCAGACGG + Intronic
946182059 2:217954796-217954818 GTGTTCCCCAGGCCCCCTGTGGG + Intronic
948274046 2:236694803-236694825 TGGGCCCCTCAGCCCTCTGTGGG + Intergenic
1170614009 20:17934793-17934815 GGGGCCCTCAATCCCCCAGGAGG - Intergenic
1172174041 20:32961540-32961562 GCGGCCCCCAAGGCCTCTGAAGG + Intergenic
1173858358 20:46266007-46266029 GGGGCCCAGATGCCCCCTCTGGG + Intronic
1173956984 20:47040988-47041010 GGGGGCCAGAAGCACCCTGTGGG + Intronic
1175190046 20:57205556-57205578 CAGGCTCCCAAGGCCCCTGTAGG + Intronic
1175417368 20:58810805-58810827 CAGGCCCCCAGGCCCACTGTGGG + Intergenic
1175981604 20:62741481-62741503 GGGACCCCCAAGCCAGCTGGGGG - Intronic
1176075783 20:63247669-63247691 GGGGCCCCGAGGCCCACTGCTGG + Exonic
1176076139 20:63249050-63249072 GGGTCCCCCAAGCCCACCCTGGG + Intronic
1176127099 20:63480491-63480513 GGGGGCACCAAGCACCCTGCAGG + Intergenic
1176133225 20:63505981-63506003 GGCGCCTCCAAGCACCCTCTCGG + Intergenic
1176777895 21:13155905-13155927 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1179150849 21:38806606-38806628 GGGGCGCCCAAGACACCTGAAGG + Intronic
1179717292 21:43296077-43296099 GGGGCCCCCAAGGGCCCACTGGG - Intergenic
1179875910 21:44267327-44267349 GGGGCTCCCCAGCCCCCAGCGGG - Intergenic
1180525673 22:16257331-16257353 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1180527256 22:16304071-16304093 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1180744513 22:18078408-18078430 GGGTCCCCCGAGCCCCCTGAGGG - Exonic
1184666198 22:45990355-45990377 GAGGCCCCCCAGCACCCTGCTGG - Intergenic
1184879687 22:47297061-47297083 GGGGACTCCAAGCCTCCTGAGGG + Intergenic
1184943277 22:47783917-47783939 GGAGCCCCCAAGAACCCTGAAGG - Intergenic
1184980009 22:48089390-48089412 TGGGCCCCCATTCCCCCTGCAGG - Intergenic
1185322026 22:50205875-50205897 GGGGCCCCCACACCCACAGTGGG - Intronic
1203322698 22_KI270737v1_random:83582-83604 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
950100321 3:10352612-10352634 GTGGCCCCCAAACCCCGAGTGGG - Intronic
950166627 3:10805639-10805661 GGGGCTCCCAAGATCTCTGTGGG - Intergenic
951603504 3:24403451-24403473 GGGGACTCCAAGCCTCTTGTAGG + Intronic
952878996 3:37971328-37971350 GGGGCCCAAATGCCCACTGTAGG - Intronic
952885931 3:38010967-38010989 GGGTCCTCAAAGCCCCCTGAAGG + Intronic
952886920 3:38017768-38017790 GGGGCCTCCTAGCCACCTGCAGG + Intronic
953414033 3:42705404-42705426 GGTGCCCCAGAGGCCCCTGTGGG + Intronic
953663851 3:44911189-44911211 GGGGCCCCTAAGAACCCTGAGGG + Intronic
954333742 3:49904227-49904249 TGGGCCCCCAGGCCACCTCTGGG - Intronic
954451137 3:50572282-50572304 GGGGCCCCAGTGCCCCCTGGAGG - Intronic
955376439 3:58401248-58401270 GGGGCCCTGAAGAGCCCTGTGGG + Intronic
956766296 3:72487327-72487349 CTGGCTCCCAAGCCCCCTCTGGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
959539803 3:107525042-107525064 GGGGCCCCCACGCCGCCAGTGGG - Intronic
961003757 3:123391052-123391074 GCGGCCCCCAAGCCCCTGGAGGG - Intronic
961447527 3:126987851-126987873 TGGGACCCCAAGCCCCATGCTGG - Intergenic
961556405 3:127699118-127699140 GGGACCCCAAAGCCTCCTCTTGG + Intronic
965160658 3:165129264-165129286 GGGGACCCCAAGAGCCCAGTTGG + Intergenic
967932859 3:194702978-194703000 TGAGCCCCAAAGCCCCATGTTGG - Intergenic
968004981 3:195236555-195236577 GGGGACCCCAAGGGCCCAGTTGG + Intronic
968660900 4:1798317-1798339 GGGGGCCCCAGTCCCCCTGCAGG + Intronic
969492791 4:7509603-7509625 GGTTCACCCCAGCCCCCTGTGGG - Intronic
974794599 4:66732177-66732199 ATGGCCCCCAGGCCCCCTGGTGG + Intergenic
976751567 4:88455490-88455512 TGGGCCCCCAAGTCCCTTGTGGG + Intergenic
977729269 4:100331722-100331744 GGTGCCCCGAAGTCACCTGTAGG - Intergenic
981731988 4:147909260-147909282 GGAGCCCCCATGCCCTCAGTGGG + Intronic
983780132 4:171660031-171660053 GGGGCCCCCAAACAGCCTCTTGG + Intergenic
985573911 5:664971-664993 GCCGCCCCCCAGCCCCCTCTGGG + Exonic
985784868 5:1888131-1888153 GGGGCCCCCCAGCTCCCTGAGGG - Intergenic
987042669 5:14077572-14077594 GGAGTCCCCTAGCCCCCTGAAGG + Intergenic
990397227 5:55394685-55394707 GGGGTCCCCAAGCCCCGGGATGG - Intronic
993047032 5:82879409-82879431 GGGGTCTCCAAGACCCCTTTTGG - Intergenic
996765572 5:127031262-127031284 CGAGCGCCCAAGCCTCCTGTTGG - Intergenic
999345721 5:150817327-150817349 AGGTCCCCCAAGCCCCAGGTGGG - Intergenic
1001960979 5:175880278-175880300 GGGGCCCCCCTGACCCCTGCTGG - Exonic
1002401268 5:178992694-178992716 GGAGCCCCATAGCCCCCTCTTGG - Intronic
1002928259 6:1617522-1617544 GGGGCCCCACAGCCTTCTGTGGG - Intergenic
1006472923 6:34238137-34238159 GGGGCACCCAAGCCCGCCTTGGG - Intronic
1006933069 6:37698960-37698982 GGCGCCCCCAAGCGCCCCGGGGG + Intronic
1007753363 6:44083319-44083341 GGAGCCCCCCAGCTTCCTGTGGG + Intergenic
1008909826 6:56720938-56720960 GGGGCCCCCCACCCCCCAGACGG + Intronic
1011092121 6:83615271-83615293 GGGTCCCCCAAACCCCATATAGG - Intronic
1011940963 6:92842617-92842639 GGGGTCCCCAAGGCCCTTTTAGG + Intergenic
1012401830 6:98847919-98847941 GGGACCCCTAAGCCCACTCTAGG - Intergenic
1017991527 6:159493265-159493287 GGGGCCTCCAGGCCCGATGTCGG - Intergenic
1019409566 7:900671-900693 GGGGACCCCAGCCCCTCTGTGGG - Intronic
1019597675 7:1865846-1865868 GGAGCCCCGAAGCCCCCAGGCGG - Intronic
1023045729 7:36208628-36208650 TGGGCCCCCTATCCCTCTGTTGG + Intronic
1025475002 7:60908239-60908261 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1025487897 7:61074752-61074774 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
1025511999 7:61581635-61581657 GGGGTCCCCAAGTCCCCCTTTGG + Intergenic
1025563371 7:62399606-62399628 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1025566090 7:62435719-62435741 GGGGTCCCCAAGTCCCCCTTTGG - Intergenic
1026989235 7:74573856-74573878 TGCGCCCCCAAGGCCTCTGTTGG - Intronic
1029437103 7:100569534-100569556 GGGGCCTCCATGCACCCTGCTGG - Intergenic
1029735880 7:102465445-102465467 GGGGCATCCTAGCCCCCTCTAGG - Intronic
1032092022 7:128915868-128915890 GGGGCTCCCAGGCGCCCTGCTGG - Intergenic
1032383492 7:131506208-131506230 GTGGCTCCGAAGCCCCTTGTGGG - Intronic
1032506044 7:132435448-132435470 GGGGCTCCCAAGCAGCCTGGAGG + Intronic
1033090224 7:138378898-138378920 GGGGCCCCCCACCCCCCAGACGG + Intergenic
1034563470 7:151896066-151896088 AGGGCCCCCAAGGCTCCTCTGGG - Intergenic
1035016845 7:155774110-155774132 GGGGCCCCACAGCCCACAGTAGG - Intronic
1035171973 7:157021893-157021915 GGGGCTCCCAAGACCCCGGCGGG - Intergenic
1035685745 8:1522405-1522427 GAGGTCCCCCAGGCCCCTGTGGG - Intronic
1037887929 8:22604836-22604858 GGGCCCCCCAACCCACCTGCGGG - Exonic
1038477709 8:27879751-27879773 GGGGCCTCCACGCCACCTGCCGG + Exonic
1039915652 8:41858596-41858618 TTGGCCACCAAGCCCTCTGTGGG - Intronic
1041485378 8:58370497-58370519 GGGGCCTCCAAGCCACGTGCAGG - Intergenic
1044929159 8:97235163-97235185 GGGGCTCTGAAGCCCCCTGGAGG - Intergenic
1045589960 8:103582472-103582494 GGGGACCCCAAGAGCCCTCTTGG - Intronic
1049467224 8:142757108-142757130 GGGGTCCCCAGGCCCCATGTGGG + Intergenic
1049656712 8:143802289-143802311 GGGGCCCCCACGCTGGCTGTGGG + Intronic
1049761292 8:144333016-144333038 GGGGCCGGCAAGGCCCCTGGCGG + Exonic
1052410032 9:28111229-28111251 GTAGCCCCCAAGCCCCCGATAGG - Intronic
1057016584 9:91657677-91657699 GGGGCCCCCATCCCCTCTGCTGG + Intronic
1059914908 9:119088145-119088167 GGGTCTCCAAAGCACCCTGTGGG - Intergenic
1060204569 9:121674962-121674984 GGTGATCCCAAGACCCCTGTGGG + Intronic
1061090054 9:128421231-128421253 GAGGACCCCGAGCCCCCTGCTGG + Intronic
1061193477 9:129095233-129095255 GGGGCCTGCAGGCCCCCTGGAGG + Exonic
1061235638 9:129341290-129341312 GGGGACCCCAGGGCCACTGTGGG - Intergenic
1061288758 9:129639148-129639170 TGGGCCCCCAGGCACCTTGTGGG - Intronic
1061677975 9:132229116-132229138 GAGGCCCCCAAGCCCCAGGAAGG + Intronic
1061791323 9:133060785-133060807 GGGGCGCCCCAGCCACCTGCAGG + Intergenic
1061795001 9:133081352-133081374 GGGGCGCCCCAGCCACCTGCAGG + Intronic
1062290851 9:135793739-135793761 GGTGCCCACTAGCCCTCTGTGGG + Intergenic
1062363633 9:136198860-136198882 GGGGCCCCCAAGGCCGCGGGCGG + Intronic
1062618720 9:137409821-137409843 GGGGCTCCCCAGCTCCCTGATGG + Intronic
1062651289 9:137578991-137579013 CAGGCTCCCACGCCCCCTGTCGG + Intergenic
1189299864 X:39944639-39944661 GGAGCCTCCAAGGCCCCTGAGGG + Intergenic
1189599342 X:42605880-42605902 TGGTCCCCTAAGCCCCCTGTGGG - Intergenic
1189703478 X:43735807-43735829 GGGCCCCCCAGGCTCCCTTTGGG - Intronic
1191250008 X:58255777-58255799 GGGGTCCCCGAGACCCCCGTGGG - Intergenic
1191251939 X:58263961-58263983 GGTGCCCACCAGCCCCCCGTGGG - Intergenic
1191252342 X:58265587-58265609 GGGACCCCCAAGACCCCCGCGGG + Intergenic
1191828764 X:65392655-65392677 GGGGCCCCCCACCCCCCAGATGG - Intronic
1192238741 X:69313398-69313420 TGGGCCCCCAAGTCCCCTGAGGG - Intergenic
1192694466 X:73399802-73399824 GGGGACCCCAAGATCCCTTTAGG - Intergenic
1193985717 X:88238160-88238182 GGAGACCCCAAGCCGACTGTTGG - Intergenic
1195172192 X:102280786-102280808 AGGTCCCCCAAGCCCCAGGTGGG + Intergenic
1195186668 X:102406307-102406329 AGGTCCCCCAAGCCCCAGGTGGG - Intronic
1195217151 X:102713040-102713062 GGGGCCCCACAGGCCCCTTTCGG - Intronic
1196085738 X:111681090-111681112 GGGGCCCCGCCGCCCCCTGGCGG + Intronic
1199772693 X:150984297-150984319 CGGGCCCCCGAGCCCCCGGGCGG + Intronic