ID: 1122789672

View in Genome Browser
Species Human (GRCh38)
Location 14:104178961-104178983
Sequence TTGGGCAGTGGGTGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1008
Summary {0: 1, 1: 0, 2: 9, 3: 80, 4: 918}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122789656_1122789672 12 Left 1122789656 14:104178926-104178948 CCCAGCCCAAGCCTGTTGCAGCT 0: 1
1: 0
2: 1
3: 12
4: 187
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789657_1122789672 11 Left 1122789657 14:104178927-104178949 CCAGCCCAAGCCTGTTGCAGCTC 0: 1
1: 0
2: 1
3: 17
4: 192
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789658_1122789672 7 Left 1122789658 14:104178931-104178953 CCCAAGCCTGTTGCAGCTCCGAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789660_1122789672 1 Left 1122789660 14:104178937-104178959 CCTGTTGCAGCTCCGACACTCCC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789654_1122789672 17 Left 1122789654 14:104178921-104178943 CCCTGCCCAGCCCAAGCCTGTTG 0: 1
1: 1
2: 13
3: 131
4: 710
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789655_1122789672 16 Left 1122789655 14:104178922-104178944 CCTGCCCAGCCCAAGCCTGTTGC 0: 1
1: 0
2: 5
3: 57
4: 390
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918
1122789659_1122789672 6 Left 1122789659 14:104178932-104178954 CCAAGCCTGTTGCAGCTCCGACA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG 0: 1
1: 0
2: 9
3: 80
4: 918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122789672 Original CRISPR TTGGGCAGTGGGTGGGTGGC TGG Intronic
900204339 1:1425709-1425731 TGGGACAGGGGGTGGGGGGCTGG + Intergenic
900291468 1:1925470-1925492 CAGGGCAGGGGGTGGGTGGTGGG + Intronic
900302382 1:1984513-1984535 GTGGGCAGTGGGAGGGGTGCAGG - Intronic
900381367 1:2385653-2385675 CTTGGCACTGGGGGGGTGGCGGG + Intronic
900401678 1:2475332-2475354 CTGGGCAGTGGGTGGGAAGAAGG + Intronic
900495652 1:2974847-2974869 TTGGGGACTGGCTGGGTGGGTGG + Intergenic
900573497 1:3371555-3371577 TGGGTGAGTGGGTGGGTGGATGG - Intronic
900698173 1:4025886-4025908 TTGGGCAGGATGTGGGAGGCAGG + Intergenic
900825210 1:4920849-4920871 TGAGGCAGTGGGTGAGGGGCAGG - Intergenic
900985893 1:6072658-6072680 TGGGGGAGTGGGTGGGGGGCTGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901318013 1:8322028-8322050 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
902339676 1:15774810-15774832 TTGTGCACTGGGTGGGGTGCAGG + Exonic
902375844 1:16029601-16029623 TCTGGCAGTGGGTGCATGGCTGG + Intronic
902380789 1:16051348-16051370 TCTGGCAGTGGGTGCATGGCCGG + Intronic
902402897 1:16167653-16167675 TGGGGGAGTGGGTGGGGGGATGG + Intergenic
902568771 1:17333164-17333186 CTAGGGAGTGGGTGGGAGGCAGG + Intronic
902665251 1:17933100-17933122 TTTGGGAGTGGGTGGATGGGTGG - Intergenic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
903213401 1:21830726-21830748 TGGGGGAGTGCCTGGGTGGCGGG + Intronic
903248927 1:22038142-22038164 CTGAGCAGTGAGTGGGTGCCAGG + Intergenic
903287130 1:22284351-22284373 TGGGTGAGTGGGTGGATGGCTGG - Intergenic
903365526 1:22803225-22803247 TAGGGCAGCGGGTGGGAGGTGGG - Intronic
903374976 1:22860188-22860210 TTGGAGAGTGGGTGGGTGGGAGG + Intronic
904197140 1:28794401-28794423 TAGGGCAGGGGGTGGGGAGCTGG - Intergenic
904291082 1:29486149-29486171 GCAGGCAGTGGTTGGGTGGCAGG + Intergenic
904444074 1:30553417-30553439 TGGGGCTGTGGGTGGTTGGGTGG - Intergenic
904552062 1:31327146-31327168 TTGGGGAGTTGGTTGGTGTCAGG - Intronic
904646872 1:31974328-31974350 TGGGGAAGTGGGAGGTTGGCAGG - Intergenic
904842061 1:33379303-33379325 GGGGGCAGTGGGGGGGTGGGGGG - Intronic
905241266 1:36583141-36583163 TTGGTGGGTGGGTGGGTGGGTGG - Intergenic
905282831 1:36860074-36860096 TTAGGGAGTGGGTAGGAGGCGGG - Intronic
905285298 1:36875489-36875511 TTGGCCAGTGGGATGTTGGCAGG + Intronic
905309984 1:37042536-37042558 CGGGGCAGGGGGTGGGGGGCTGG + Intergenic
905978889 1:42204702-42204724 TGGGGCAGTTGGGGGGTGGGGGG - Intronic
906153054 1:43598922-43598944 TTGGGTGGTGGTGGGGTGGCAGG + Intronic
906202394 1:43968367-43968389 TTGGGGGGTGGGTGGGTGGCAGG + Intergenic
906381267 1:45333373-45333395 AGGGACAGTGGGTGGGAGGCAGG - Intronic
906464347 1:46062813-46062835 TTGGTTGGTGGGTGGGTGGGTGG + Intronic
906524371 1:46485843-46485865 CGGGGCAGTGGCTGGGTGGTGGG - Intergenic
906615388 1:47229875-47229897 TTGGGCTGGAGGTGGGTGGATGG - Intronic
906942823 1:50271314-50271336 AAGGGCAGGGGGTGGGGGGCGGG - Intergenic
907267718 1:53272843-53272865 GGGGGCAGTGGGTGAGTGGGAGG - Intronic
907440126 1:54473863-54473885 TTGGGCACTGGGAGGGTGGCAGG - Intergenic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907515629 1:54991628-54991650 TGGCGCAGGGAGTGGGTGGCGGG + Intronic
907567451 1:55449094-55449116 TTAAGAAGTGGGTGGGTGGGAGG - Intergenic
908082639 1:60597848-60597870 AAGGGCAGGGGATGGGTGGCGGG - Intergenic
908160755 1:61406544-61406566 TTGGGCTGTGGGGGGGGGGGGGG - Exonic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
910167178 1:84339730-84339752 TTGAGGAGTGAGTGGGAGGCAGG + Intronic
911375429 1:97045040-97045062 TTTGGCAGTGTGTGGGAAGCGGG + Intergenic
912302621 1:108533856-108533878 TTGGGGTTTGGGTGGGTGGTGGG - Intergenic
912415071 1:109502492-109502514 GTGGGTGGTGGGTGGGTGGGGGG + Intronic
912654914 1:111477597-111477619 TTGGCAGGTGGGTGGGGGGCAGG - Intronic
912727922 1:112075845-112075867 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
912734814 1:112141357-112141379 TGGAGCTGTGGGTGGGTGGCTGG + Intergenic
912756596 1:112329588-112329610 TGGGGCAGAAGGTGGGTGGGTGG - Intergenic
913004876 1:114619514-114619536 TTGGGGGGTGAGTGGTTGGCAGG - Intronic
914443563 1:147728985-147729007 TTGGGGAGTAGGGGGGTGGAGGG - Intergenic
915179633 1:154047101-154047123 AAGGGCAGTGGGTGGGTAGGGGG + Intronic
915244701 1:154548172-154548194 CAGGGCAGTGGAAGGGTGGCTGG - Intergenic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
915684505 1:157617716-157617738 GTGGGCTGGGGGTGGGTGGGGGG + Intergenic
915838984 1:159200707-159200729 TTGAGCAGTGTGTGAGTGGGTGG + Intronic
917481678 1:175417324-175417346 GTGGGCAGTGGGTGGGAGAGGGG + Intronic
917678489 1:177342199-177342221 CAGGGAAGTGGGTGGGTGTCAGG - Intergenic
917731180 1:177876622-177876644 CTGGGCAGTGGGGAGGAGGCTGG + Intergenic
917845794 1:179019265-179019287 ATGAGCAGTGGTTGGGTGGCTGG + Intergenic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918550871 1:185740677-185740699 TTGGGCAGGGGGTGGGGGGTAGG + Intronic
919991881 1:202713049-202713071 TTAAGCAGAAGGTGGGTGGCAGG - Intergenic
920074624 1:203327311-203327333 GAGGGACGTGGGTGGGTGGCTGG - Intergenic
921101800 1:211934854-211934876 CTTGGGAGTGGGTGGGGGGCAGG + Intergenic
921148613 1:212382393-212382415 TTGGGCAGTGGGAAAATGGCGGG + Intronic
921314380 1:213876436-213876458 TCGGGCAGGGGGTGGGTGGGAGG + Intergenic
922117410 1:222627409-222627431 TTGGGCAGTGGGTGGATAGGAGG - Intronic
922790917 1:228310558-228310580 TGGATCAGTGGGTGGGTGGATGG - Intronic
922896314 1:229103043-229103065 TTGAGCAGTGTTTGGGTAGCAGG - Intergenic
923766886 1:236900825-236900847 TTGGGGAATGAGTGGATGGCTGG + Exonic
924148780 1:241106010-241106032 TTGGGCAGTTAGGTGGTGGCAGG + Intronic
924154220 1:241159502-241159524 TAGGTGAGTGGGTGGGTGGATGG - Intronic
924411061 1:243806132-243806154 TTGGGTGATGGGTGTGTGGCAGG - Intronic
924434053 1:244023040-244023062 TAGGACAGTGGGAGGGTGGTGGG + Intergenic
924450463 1:244174317-244174339 TTGGGGTGAGGGTGGGAGGCTGG + Intergenic
1062791938 10:312442-312464 TGGGGTTGTGGGTGGGTGCCGGG - Intronic
1062827309 10:582139-582161 TGTAGCAGGGGGTGGGTGGCCGG - Intronic
1063455204 10:6178156-6178178 TTGGGCTGTGGGGAGCTGGCGGG + Intronic
1063464139 10:6232242-6232264 TTTTGCGGGGGGTGGGTGGCGGG + Intronic
1063601290 10:7483429-7483451 TTGAGCAGTGAGTGGGTAACGGG - Intergenic
1064744041 10:18461694-18461716 GTGAGCAGTGGGTGAGTGGGTGG - Intronic
1065034284 10:21621693-21621715 ATGGGCAGTGCATGGGAGGCAGG - Intronic
1065297395 10:24289806-24289828 TTGGGCTGTGTGGGGGTGGTAGG + Intronic
1067053980 10:43040768-43040790 TTGGGCAGTGGGGCGCTGACAGG + Intergenic
1067556458 10:47276721-47276743 TTGTGCAGTCAGAGGGTGGCAGG - Intergenic
1068335823 10:55631135-55631157 TTGGGCAGAGGCTGGGGTGCCGG - Intergenic
1068777357 10:60882615-60882637 GTGGGGGGTGGGAGGGTGGCTGG + Intronic
1068931665 10:62596558-62596580 TTGGCCATGGGGTGGGTGGGTGG - Intronic
1068964001 10:62893523-62893545 TTAGACAGTGGCTGGGTGGAGGG + Intronic
1069756872 10:70778819-70778841 TGTGGCAGTGGGTGGGGTGCGGG + Intronic
1069781247 10:70957100-70957122 GGGGGCAGGGGGTGGGTGCCAGG - Intergenic
1069784233 10:70977676-70977698 GTGGGAGGTGGGTGGGTGGAGGG + Intergenic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1071620690 10:87116516-87116538 TGGGGAAGTGTTTGGGTGGCAGG + Intronic
1071837778 10:89436564-89436586 TTAGGCAGGCAGTGGGTGGCAGG - Intronic
1072155859 10:92723076-92723098 TTGAACAGGAGGTGGGTGGCAGG + Intergenic
1072796078 10:98355504-98355526 CAGGGCAGTGGGTGTGTGGCTGG + Intergenic
1073094549 10:100971721-100971743 ATGGGATGGGGGTGGGTGGCAGG - Intronic
1073376471 10:103039719-103039741 TAGGGCAGTGAGTGAGGGGCTGG + Intronic
1074376718 10:112946918-112946940 TTGGGAAATGGGTGGGAGGGGGG - Intergenic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1074425186 10:113344429-113344451 TGGGGAGGTGGGTGGGTGGAGGG + Intergenic
1074852281 10:117448440-117448462 TTGTGGAGTGGGTGGGTAGATGG + Intergenic
1074909362 10:117893694-117893716 TTGGGAAGTGGGGGGTGGGCAGG - Intergenic
1074963361 10:118467726-118467748 TTGGCAAATGGGTGGCTGGCAGG + Intergenic
1075065701 10:119287694-119287716 TGTGGGAGTGGGTGGGGGGCTGG - Intronic
1075648078 10:124109484-124109506 TGAGGCAGTGGGTGGGGCGCTGG + Intergenic
1075778682 10:125003512-125003534 GAGCACAGTGGGTGGGTGGCTGG + Intronic
1075961573 10:126571663-126571685 TGGGGCACTGGGTGGGTTGAGGG + Intronic
1076138880 10:128064160-128064182 TGGGGCAGAAGATGGGTGGCAGG + Intronic
1076546415 10:131248590-131248612 TTGGGCTGTGTGTGGCTGGAGGG + Intronic
1076740120 10:132478694-132478716 AGGGGCAGTTGCTGGGTGGCAGG + Intergenic
1076820140 10:132934254-132934276 GTGGGCACGGGGTGGGTGGGGGG - Intronic
1076888884 10:133274484-133274506 GAGGGCAGAGGGTGGGGGGCGGG + Intronic
1076905110 10:133357598-133357620 CGGGGCAGGGGTTGGGTGGCCGG - Intronic
1076931709 10:133536370-133536392 TAGGGGAGTGGATGGATGGCTGG + Intronic
1077076733 11:705640-705662 TCGGTGAGTGGGTGGGTGTCAGG - Intronic
1077106387 11:844229-844251 CTGGGGAGTGGGTGGGGGCCTGG + Intronic
1077150294 11:1070125-1070147 TGGGTCAGTGGGTGGGTAGATGG - Intergenic
1077155236 11:1088163-1088185 CAGGGCAGGGGGTGGGGGGCTGG - Intergenic
1077198394 11:1293040-1293062 GGGGGCAGTGGGTGGGTGCGGGG + Intronic
1077213521 11:1384352-1384374 TGGGTGGGTGGGTGGGTGGCAGG - Intergenic
1077264265 11:1641320-1641342 CTGGGCTGTGGCTGGGTGGTTGG + Intergenic
1077279573 11:1736412-1736434 TTGGCCTGTGGGTGGATGGATGG + Intronic
1077282256 11:1751077-1751099 CTGGGCAGAGGCTGTGTGGCAGG - Intronic
1077288573 11:1778457-1778479 TTTGGCTGTGGGTGGGAGGTAGG - Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077319124 11:1933156-1933178 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1077333957 11:1995097-1995119 TTGGGCAGAGGGGGGCTGGGGGG - Intergenic
1077359613 11:2134883-2134905 AAGTGCAGTTGGTGGGTGGCAGG - Intronic
1077374124 11:2197617-2197639 TGGGGCAGGGGAAGGGTGGCGGG + Intergenic
1077774744 11:5258522-5258544 CTGGGCAGTGGGGGGGTTGGTGG + Intronic
1077898023 11:6468634-6468656 TTTGGCTGTGGTGGGGTGGCAGG + Intronic
1078537290 11:12185194-12185216 TGGGGGGATGGGTGGGTGGCAGG + Intronic
1078663198 11:13303766-13303788 CTGGCCAGTGGGTGGGAGGGAGG - Intronic
1079300942 11:19278504-19278526 TTTGGCAGAGGCTGGGGGGCTGG - Intergenic
1079313975 11:19391674-19391696 TGGGGCAGTGGGGGAGGGGCAGG + Intronic
1079340853 11:19610799-19610821 TGGGGCAGTGGATGGATGGATGG + Intronic
1081655455 11:44854188-44854210 TGGGGCAGGGGGTGGGGGGGGGG + Intronic
1082806996 11:57458065-57458087 CTGGCTGGTGGGTGGGTGGCTGG - Intergenic
1082837391 11:57661368-57661390 TTAGGCAGTGGGCGAGGGGCTGG - Exonic
1082975725 11:59069957-59069979 TTGGGCAGTGGGGGGGCTGAAGG + Intergenic
1083087785 11:60168352-60168374 TTGGGAGATGGGTGTGTGGCAGG - Intergenic
1083187689 11:61027022-61027044 TTCTGCACTTGGTGGGTGGCTGG - Intergenic
1083201233 11:61122289-61122311 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
1083201268 11:61122416-61122438 TGGATCAGTGGGTGGGTGGATGG + Intronic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083268085 11:61556249-61556271 CTGGGCTGAGGGAGGGTGGCAGG - Intronic
1083307668 11:61769574-61769596 TTCGGCGGTAAGTGGGTGGCTGG + Intronic
1083517947 11:63278327-63278349 TTGGGTGGTGGGTGGGTTCCTGG + Intronic
1083702303 11:64487457-64487479 TTGGGCAGGGGGTGGGTGAGTGG + Intergenic
1083737030 11:64687294-64687316 TGAGGCAGTGGGGTGGTGGCGGG + Intronic
1083823320 11:65184427-65184449 TTGCGGAGAGTGTGGGTGGCGGG - Intronic
1083898204 11:65630832-65630854 TTGGGCAGTGAGTATGGGGCAGG + Intronic
1084030246 11:66476666-66476688 GTGAGTGGTGGGTGGGTGGCAGG + Exonic
1084316664 11:68349653-68349675 GTGGGGAGAGCGTGGGTGGCAGG + Intronic
1084413461 11:69016971-69016993 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1084545906 11:69815024-69815046 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084548047 11:69824153-69824175 TTGGACAGTGGGCAGGAGGCAGG + Intergenic
1084596345 11:70119121-70119143 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084664560 11:70569451-70569473 CTGGGCAGAGGGTGGATGGCGGG + Intronic
1084678283 11:70649620-70649642 GTGGGCAGTGGGTGTATGGGAGG + Intronic
1084699434 11:70776881-70776903 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084765568 11:71305963-71305985 AAGGGCTGTGGGTGGGGGGCGGG + Intergenic
1084792968 11:71486459-71486481 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1085449390 11:76622863-76622885 TTGGGAAGCAGGTGGGTGTCAGG - Intergenic
1085464314 11:76713634-76713656 TTGGTCAGTGGGTGGATGGGTGG + Intergenic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1085763142 11:79259617-79259639 TGGGGGAGTGGATGGGTGGAGGG - Intronic
1086891105 11:92259002-92259024 TTGGGCTGTGTGTGGGGGGCGGG + Intergenic
1087713966 11:101585155-101585177 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1087884389 11:103460471-103460493 TGGGGCAGTGGGTGGGGTGGGGG + Intronic
1088514706 11:110618083-110618105 GGGGGCAGGGGGTGGGTGGAAGG - Intronic
1088568055 11:111194465-111194487 TTGGGCTGTGGGTTGGCAGCAGG - Intergenic
1088680001 11:112231842-112231864 TGGGGCAGGGGTTGGGGGGCAGG + Intronic
1088870447 11:113886189-113886211 GGGGGCAGGGGGTGGGGGGCGGG - Intergenic
1089327283 11:117666011-117666033 TTGGGCAGTTGGTCAGTGGCTGG + Intronic
1090003205 11:122979480-122979502 GTGGGCAGAGCGTGGGTCGCCGG + Intronic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1090248732 11:125236381-125236403 TGGGGCGGGGGGTGGGTGGAGGG + Intronic
1090475882 11:127019506-127019528 TTTGCCAGTGTGTGAGTGGCAGG + Intergenic
1090517784 11:127447196-127447218 TTGGGCGGGGGGTGGGTGCAGGG + Intergenic
1090640668 11:128726522-128726544 TAGGGGGGTGGGAGGGTGGCAGG - Intronic
1091138254 11:133212336-133212358 AGGGGCAGTGGGAGAGTGGCAGG - Intronic
1202816940 11_KI270721v1_random:50279-50301 TTGGGCAGAGGGGGGCTGGGGGG - Intergenic
1091670082 12:2446449-2446471 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1091703165 12:2677403-2677425 GAGGGCAGTCGGTGGGTGGCAGG - Intronic
1091994455 12:4982294-4982316 TTGGGGTTTGGGTGGGTGGATGG + Intergenic
1092020701 12:5200064-5200086 TTAGGAGCTGGGTGGGTGGCTGG + Intergenic
1092913716 12:13171157-13171179 TTTGGCAGTGGGTGGGTGGGGGG + Intergenic
1093597134 12:20975735-20975757 TTGGGGAGTGGGGGGCTGGGGGG - Intergenic
1093872383 12:24307524-24307546 TGGGTGAGTGGGTGGGTGGGGGG - Intergenic
1094180330 12:27585775-27585797 TTTGGGAGTGGGTGGGCAGCAGG + Intronic
1095380550 12:41585744-41585766 TTGGGCAGTGGGGGAGTGGGAGG - Intergenic
1096243193 12:49970305-49970327 TTGTGCAGTGGATAGGTGGCTGG + Intronic
1096751092 12:53759272-53759294 CTGGGTAGAGGGTGGGAGGCTGG - Intergenic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1097022101 12:56027700-56027722 TAGGGCAGAGGGTGGGTGATAGG + Intronic
1097338826 12:58414735-58414757 GTGGGGAGTGGGTGGGGGGGTGG + Intergenic
1097476534 12:60063797-60063819 TGGGGGAGGGGGTGGGTGGATGG - Intergenic
1098350670 12:69555989-69556011 TTGATCAGTGTGTGTGTGGCGGG + Intronic
1098385132 12:69910392-69910414 TTGGGCAGTCGGGAGGTGGAGGG + Intronic
1099021333 12:77408172-77408194 TTGGGCAGTGGGTGGATCTCAGG + Intergenic
1099599459 12:84714195-84714217 TTGGGTACTGGGTGGCTGGTGGG + Intergenic
1100656370 12:96650304-96650326 CTGGGCTCTGGGTGGATGGCTGG - Intronic
1101175970 12:102151847-102151869 TTGGACAGTGAGTTGGTGCCAGG - Intronic
1101319648 12:103662326-103662348 TACTGCAGGGGGTGGGTGGCAGG + Intronic
1101764328 12:107684198-107684220 GTGGGCAGTGGGGGAGTGGGTGG + Intergenic
1101823390 12:108201507-108201529 TTGGGGTGTGGGTGGGGGGCGGG + Intronic
1101967218 12:109290057-109290079 CTGCACAGTGGGTGGGTGGCAGG + Intronic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102304179 12:111792235-111792257 TTGGGCACTGGGGGGGCGACAGG - Intronic
1102537133 12:113590025-113590047 TTGGGAATTGGGTGGGTGTGTGG - Intergenic
1102619471 12:114182579-114182601 GTTGGCAGCGGGTGGGTGGGTGG + Intergenic
1103444844 12:120988067-120988089 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103444861 12:120988130-120988152 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103444894 12:120988256-120988278 TTGGTGGGTGGGTGGGTGGATGG - Intronic
1103506290 12:121443920-121443942 TGGGGCAGGGGGTGGGCAGCAGG - Intronic
1103593827 12:122010952-122010974 ATGGGAAGTGGGTAGGTGGCGGG + Intergenic
1103865506 12:124048928-124048950 ATGGGCAGTGGGTGTGTGGGTGG - Intronic
1103908019 12:124337116-124337138 GTGGGCAGTGGGTGGCAGGTGGG + Exonic
1104162461 12:126193003-126193025 TTTGGAGGTGGGTGGGGGGCGGG - Intergenic
1104528087 12:129543204-129543226 TTGGTGAGTGGGTGGGTGGGTGG + Intronic
1104803187 12:131568681-131568703 ATGGTGAGTGGGTGGGTGGATGG - Intergenic
1104858908 12:131914781-131914803 TGGGCCAGTGGGTGTCTGGCAGG + Intronic
1104954424 12:132457468-132457490 CGGGGGAGTGGGTGGGTGGGTGG + Intergenic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1104997826 12:132669808-132669830 TTGGGCGGAGGGTGGCTGGGGGG - Intronic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1105589056 13:21774451-21774473 TTGGAAAGTGAGTGGGTGGTGGG - Intergenic
1105638101 13:22235736-22235758 TGGGGCTGAGAGTGGGTGGCTGG + Intergenic
1105821875 13:24087287-24087309 GTGTGCAGGGGGTGGGTAGCAGG - Intronic
1105989312 13:25602624-25602646 TTGAGCAGTGTGTGGCTGGAGGG + Intronic
1106753446 13:32797629-32797651 TTGGGCGGGGGGTGGGGGGGTGG - Intergenic
1107018659 13:35729979-35730001 TTTGGCAGAGGGCTGGTGGCAGG - Intergenic
1107215703 13:37916159-37916181 TTGGGCAGTGGTTGGGGAGGGGG - Intergenic
1108378789 13:49837428-49837450 ATGGGCAGGGGGTGGGAGACAGG + Intergenic
1108461923 13:50675586-50675608 TAGGGCGGTGGGAGGGTGGCAGG - Intronic
1108807804 13:54181409-54181431 GTGGGCAGAGGGTGGGAGGAGGG - Intergenic
1109191081 13:59325008-59325030 GAGGGCAGTGGGTGGGAGGAGGG + Intergenic
1110143852 13:72165750-72165772 TTGGGTAGAGGGTGGGAGGAGGG - Intergenic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110949842 13:81472058-81472080 TGGGGGAGTGGGTGGGAGGTGGG + Intergenic
1111381840 13:87464834-87464856 TTGGCCAATGGGTGGGTGGGTGG + Intergenic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1114212556 14:20627462-20627484 TGTGGCGGTGGGTGGGTGGGGGG - Intergenic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114755260 14:25252620-25252642 TAGGGCAGCTGGCGGGTGGCGGG + Intergenic
1114934528 14:27516799-27516821 TTGGAAAGTGGGGGGGTGGAGGG - Intergenic
1115374635 14:32660918-32660940 TTGGGAGGGGGGGGGGTGGCGGG - Intronic
1115976813 14:39005631-39005653 TGGGGCTGGGGCTGGGTGGCAGG - Intergenic
1116250979 14:42482400-42482422 TTGGGCAGTGGATGGGCGATGGG + Intergenic
1116469976 14:45275573-45275595 TTGGGTGGTGGGGGGGTGGATGG + Intergenic
1116828053 14:49691181-49691203 TTGGTCACTGGGTGGGAGGTGGG - Intergenic
1117031748 14:51678831-51678853 TTTTGGAGTGGGTGGGTGGGTGG + Intronic
1117548501 14:56811808-56811830 GTTGGTGGTGGGTGGGTGGCGGG - Intergenic
1118010710 14:61607902-61607924 TTGGGCTGTGGGTTGGGGGGAGG + Intronic
1118114287 14:62757802-62757824 ATGGGTAGTGGGTGGATGGGAGG + Intronic
1118371603 14:65141934-65141956 TGGGTGGGTGGGTGGGTGGCTGG - Intergenic
1118371606 14:65141942-65141964 GGTGGCAGTGGGTGGGTGGGTGG - Intergenic
1118489145 14:66242550-66242572 TTGGGTAGTGTGTGGGTGGGTGG - Intergenic
1119246642 14:73115316-73115338 TAGGGCAGAGGGTGGGAGGAGGG - Intronic
1119439062 14:74616074-74616096 ATGGGCAGTAAGTAGGTGGCAGG - Intergenic
1119477407 14:74939161-74939183 TGGGGCAGTGGCTGAGTGGTGGG - Intergenic
1120230145 14:81833125-81833147 GTGGGCAGATGGTGGGAGGCAGG - Intergenic
1120625978 14:86827054-86827076 GAGGGCAGGGGGTGGGGGGCAGG + Intergenic
1120696803 14:87653940-87653962 TTTGGCAGCTGGTGGGTGGGTGG + Intergenic
1121226037 14:92322796-92322818 GTGGGGAGGGGGTGTGTGGCGGG + Intronic
1121369488 14:93344022-93344044 CTGGGGTGGGGGTGGGTGGCAGG + Intronic
1121434255 14:93908593-93908615 TGGGGAAATGGGTGGGTGGATGG - Intergenic
1121487677 14:94331167-94331189 GTGGCCAGTGTGGGGGTGGCAGG + Intergenic
1121778356 14:96605889-96605911 TTGAGAAGTGGCTGGGTGGACGG - Intergenic
1121918384 14:97857061-97857083 TGAGTCAGTGGGTGGGTGGATGG + Intergenic
1121922899 14:97899554-97899576 TGAGGCAGTGTGTGGTTGGCTGG + Intergenic
1122214043 14:100192091-100192113 TTCGGAAGTGGGTGGGTGGTGGG - Intergenic
1122269482 14:100562140-100562162 TGGGGTAGTGGGTGGGTTGGAGG + Intronic
1122298355 14:100718030-100718052 GGGGGGAGTAGGTGGGTGGCAGG - Intergenic
1122462070 14:101904115-101904137 GTGGGTGGTGGGTGGGTGGATGG + Intronic
1122577713 14:102752308-102752330 GGGGCCAGTGGGTGGGAGGCGGG + Intergenic
1122608406 14:102963732-102963754 TTGGGCTGTGGGAGGGTCACAGG + Intronic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122805054 14:104252338-104252360 GTGGACAAAGGGTGGGTGGCAGG - Intergenic
1122848064 14:104511459-104511481 CTGGGGTGTGGGTGGGAGGCTGG - Intronic
1122923682 14:104890303-104890325 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1122923715 14:104890443-104890465 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923777 14:104890683-104890705 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1123061618 14:105597150-105597172 GGGGGCTGTGGATGGGTGGCAGG + Intergenic
1123086356 14:105718880-105718902 GGGGGCTGTGGATGGGTGGCAGG + Intergenic
1123118923 14:105908151-105908173 ATGGGCAGTGTGTGGGTGCGAGG + Intergenic
1123633033 15:22275138-22275160 TAGGTGAGTGGGTGGGTGGGTGG - Intergenic
1123699406 15:22903365-22903387 ATGGGCGGTGGGTGGGAGGGTGG + Intronic
1124352046 15:28963028-28963050 TGGGGCACTAGGTGGGTGGCAGG + Intronic
1125366647 15:38924272-38924294 TTGGTAGGTGGGTGGGTGGGTGG - Intergenic
1125484676 15:40103782-40103804 CTGGGCAGTTGGGGGGTGCCTGG - Intronic
1126097519 15:45100011-45100033 GTGGGCAGTGGGTAGGGAGCAGG - Intronic
1126104903 15:45141169-45141191 TTGGGAAGTGGGTGGTGGGCTGG - Intronic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128093196 15:64932990-64933012 GTGGCCATTGGGTGGGGGGCTGG + Intronic
1128510729 15:68312641-68312663 TCGCACAGTGGGTGGGTGGCAGG + Intronic
1128681708 15:69657283-69657305 TTGGGCAGTGGGTCAGGGGGAGG - Intergenic
1128704723 15:69830422-69830444 CTGGGCTGTAGGTAGGTGGCTGG + Intergenic
1129327230 15:74807165-74807187 TAGAGCAGGGGGTGGGTGGTGGG + Intergenic
1129366450 15:75058530-75058552 GTGGGGAGTGGGTGGGTGTGAGG + Intronic
1129577806 15:76770197-76770219 CTGGTCAGGGGGTGGGGGGCTGG + Intronic
1129698862 15:77756030-77756052 GTGGGAAGTAGGGGGGTGGCAGG + Intronic
1129839417 15:78734578-78734600 TTGTGCGGGGGGTGGGTAGCGGG + Intergenic
1129929094 15:79394135-79394157 TTGGGGAGTAGGGGGGTGGGTGG + Intronic
1130429335 15:83830954-83830976 TTGCCAAGTGGGTGGGTGGGTGG + Intronic
1130685137 15:86030689-86030711 TTGGGCAGGGGGTAGGCGGGTGG - Intergenic
1131350666 15:91696955-91696977 TGGGGACCTGGGTGGGTGGCTGG - Intergenic
1131507448 15:93030525-93030547 TGGGCCAGCGGGTGGGTGCCGGG + Intergenic
1131508691 15:93037030-93037052 CTGGGCAGTGGGTGACTGGCAGG + Intronic
1131900047 15:97077914-97077936 CTGGGCAGAAGGTGGGTGGAGGG - Intergenic
1132590428 16:724045-724067 TGGGGCAGTGGGTGGGTGGGGGG + Intronic
1132642792 16:985317-985339 TGGGGCTGTGGGCGGGCGGCAGG - Exonic
1132644719 16:993641-993663 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1132827880 16:1914050-1914072 AGTGGCAGTGGGTGGGTGGAGGG - Intronic
1133033202 16:3021313-3021335 CTGGGCTGTGAGTGGGGGGCAGG + Exonic
1133069406 16:3235592-3235614 TAGGGCGGTGGGGGAGTGGCGGG - Intronic
1133199562 16:4194858-4194880 TTTGACAGTGGGTGGTAGGCAGG - Intronic
1133358576 16:5155530-5155552 TTGGGCGGGGAGGGGGTGGCGGG - Intergenic
1133416538 16:5611674-5611696 TGGGGGAGTGGGTGGATGGATGG - Intergenic
1133416654 16:5612289-5612311 TGGGAAAGTGGGTGGGTGGGTGG - Intergenic
1133910006 16:10057048-10057070 TGGGGAATTGGGTGGATGGCTGG - Intronic
1134014575 16:10879270-10879292 CGGGGCCGTGGGCGGGTGGCAGG + Intronic
1134106967 16:11492262-11492284 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1134112515 16:11524180-11524202 GAGGGTAGTGGGTGGGTGGATGG - Intergenic
1134112544 16:11524281-11524303 GCGGGGAGTGGGTGGGTGGATGG - Intergenic
1134224714 16:12381352-12381374 TGGGTCGGTGGGTGGGTGGCTGG - Intronic
1134273878 16:12758572-12758594 TTGGTCAGTGGGCTGGTGGGAGG - Intronic
1134817269 16:17215945-17215967 TTGAGGAGTGGGTGGCAGGCAGG + Intronic
1135728370 16:24874693-24874715 TGGGGCAGTGTGTGTGTGGTGGG - Intronic
1135969273 16:27060619-27060641 TGGGGGAGTGCGTGGGTGGGAGG - Intergenic
1136127496 16:28194876-28194898 TGAGGCAGAGGGTGGGTGGGTGG - Intronic
1136136494 16:28259517-28259539 GTGGCCAGTGGGTGGGCAGCAGG + Intergenic
1136142814 16:28298196-28298218 TGGGGCGATGGGAGGGTGGCTGG - Intronic
1136279114 16:29197705-29197727 TTGATGAGTGGATGGGTGGCTGG + Intergenic
1136289732 16:29264349-29264371 CTGGGCAGAGGGTGACTGGCAGG - Intergenic
1136350043 16:29700925-29700947 TTTGGGAGGGGATGGGTGGCTGG - Intergenic
1136399428 16:30009830-30009852 GAGGGCAGTGGGGGGGTGGCAGG - Intronic
1136590138 16:31213768-31213790 TTGGGGAATGAGTGGGTGACAGG + Intergenic
1136682998 16:31978758-31978780 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1136772386 16:32852521-32852543 TTGGGGAGTGGGGGGCTGGAGGG + Intergenic
1136783638 16:32922314-32922336 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1136886152 16:33931492-33931514 TTGGGCTGAGGGAGGGTGGTGGG - Intergenic
1136898230 16:34008996-34009018 TTGGGGAGTGGGGGGCTGGAGGG - Intergenic
1137001657 16:35234859-35234881 CTGGGCTCTGGGTGGCTGGCTGG - Intergenic
1137283071 16:46994516-46994538 TTTGGCAGTGGTTAGGTGGCGGG + Intergenic
1137561673 16:49506392-49506414 TTGGTGAGTGGGTGGATGGGTGG + Intronic
1137736896 16:50731490-50731512 TTGGGGAGTCTGTGGCTGGCTGG + Intronic
1138210031 16:55155782-55155804 TTTTGCAGTGGGTATGTGGCTGG - Intergenic
1138623470 16:58230615-58230637 TGTGGTAGTGGGTGGGTGGGTGG - Intergenic
1138757866 16:59510389-59510411 CTGGGCTGTGAGTGGGTTGCTGG + Intergenic
1140067671 16:71625328-71625350 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1140249979 16:73287320-73287342 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140249995 16:73287375-73287397 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140250010 16:73287430-73287452 TGGGCCAGTGTGTGGGTGGTGGG + Intergenic
1140406261 16:74713580-74713602 TTGGGCCCAGGGTGGCTGGCAGG - Exonic
1140913383 16:79473562-79473584 TCGTGCAGTGGGTAGGAGGCTGG - Intergenic
1140949874 16:79806808-79806830 AGGGGCAGTGTGTGTGTGGCGGG + Intergenic
1141701706 16:85645301-85645323 TTGGGCAGTTCGGGGGTTGCTGG + Intronic
1141898295 16:86972627-86972649 TGGGTAAGTGGGTGGGTGGGTGG + Intergenic
1141993182 16:87621755-87621777 TTGGGGTTTGGGTGGGTGGTGGG + Intronic
1142081049 16:88148938-88148960 TCTGGCCGTGGCTGGGTGGCAGG + Intergenic
1142083507 16:88163798-88163820 TTGATGAGTGGATGGGTGGCTGG + Intergenic
1142095612 16:88237825-88237847 CTGGGCAGAGGGTGACTGGCAGG - Intergenic
1142190817 16:88716522-88716544 TGGGGCAGTGCCTGGGTGGGTGG - Intronic
1142196191 16:88740370-88740392 CTGGGAAGGGGCTGGGTGGCTGG - Intronic
1142355218 16:89598648-89598670 CTGGGCAGAGGGTGCGTGTCAGG + Intergenic
1142355246 16:89598751-89598773 CTGGGCAGAGGGTGCGTGTCAGG + Intergenic
1142355274 16:89598854-89598876 CTGGGCAGAGGGTGCGTGTCAGG + Intergenic
1142355302 16:89598957-89598979 CTGGGCAGAGGGTGCGTGTCAGG + Intergenic
1142355345 16:89599105-89599127 CTGGGCAGAGGGTGCGTGTCAGG + Intergenic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1203074809 16_KI270728v1_random:1114619-1114641 TTGGGGAGTGGGGGGCTGGAGGG + Intergenic
1203086284 16_KI270728v1_random:1186308-1186330 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1142478628 17:204611-204633 TTGGGGGATGGGTGGATGGCAGG - Intergenic
1142555854 17:776818-776840 TTTGGCTGGGGGTAGGTGGCTGG - Intronic
1143093364 17:4462849-4462871 TTGGTGGGTGGGTGGGTGGGTGG - Intronic
1143151513 17:4809805-4809827 CTGGGCAGTGGGTGGGGGTGAGG + Intronic
1143201238 17:5115189-5115211 TGGGGCGGTGGGTGGGTGGAAGG + Intronic
1143494953 17:7307531-7307553 TTGCGCAGTGCGGGGGTGGAGGG + Intronic
1143524855 17:7466151-7466173 CTGGGGAGTGGGAGGGTGACAGG - Exonic
1143532507 17:7513459-7513481 TGGGGAAGTGGGTGAGTAGCTGG - Exonic
1143756687 17:9072656-9072678 ATGGGAAGTGAGTGGGAGGCAGG + Intronic
1144102397 17:11953298-11953320 AAGGGCTGTGGGTTGGTGGCTGG - Intronic
1144659245 17:17057742-17057764 TGGGGCAGCGGGTGGGGGTCAGG - Intronic
1145252908 17:21306078-21306100 CAGGGCACTGGGTGGGTGTCTGG - Intronic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145323668 17:21781838-21781860 CAGGGCACTGGGTGGGTGTCTGG + Intergenic
1145794952 17:27650052-27650074 TTGGGCAGTGGCCCAGTGGCTGG - Intergenic
1146185209 17:30720111-30720133 TTGGGGAGTGGGCAGGAGGCAGG + Intergenic
1146684575 17:34832679-34832701 GAGGGCACTGGGTGGGTGGTGGG + Intergenic
1146937333 17:36820332-36820354 ATGGGGTGTGGGTGGGGGGCAGG - Intergenic
1147143903 17:38474467-38474489 TTGGGCTGAGGGAGGGTGGTGGG + Intronic
1147208021 17:38852820-38852842 TTGGGCAGTGAGTGGAGGGAGGG - Intronic
1147243066 17:39103285-39103307 TTGGGCACTGGGAGGCTTGCAGG + Intronic
1147316000 17:39620637-39620659 AGGGGCAATGGGTGGGGGGCAGG - Intergenic
1147324386 17:39663345-39663367 TTGGGGAGTGGGTGGCAGGTGGG + Exonic
1147387566 17:40091109-40091131 TGGGGCAGGGGGTGGGGGGAGGG + Intronic
1147454941 17:40531292-40531314 TTGGGGGTGGGGTGGGTGGCAGG - Intergenic
1147623736 17:41885754-41885776 TTTAGTAGGGGGTGGGTGGCAGG - Intronic
1147652561 17:42070898-42070920 GAGGGCAGTGGGGAGGTGGCAGG - Intergenic
1148005999 17:44430076-44430098 TTATGTAGTGGGTGGGTGGGTGG - Intronic
1148346087 17:46904411-46904433 TTGGTGGGTGCGTGGGTGGCTGG + Intergenic
1148664128 17:49362015-49362037 TTGGGCAGGGGGGGAGGGGCTGG - Intronic
1148688808 17:49515051-49515073 TTTGGGATTGGGTGTGTGGCAGG + Intergenic
1148864954 17:50623640-50623662 TTTTGCAGGGGGTGGGGGGCAGG + Intronic
1149549153 17:57527265-57527287 CTGGGGTGTGGGTGGGTGGGTGG - Intronic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1150720800 17:67612644-67612666 TTGGGGTGTGGCTGGGTGGATGG + Intronic
1150746979 17:67824751-67824773 TGGGGCACTGGGAAGGTGGCGGG + Intergenic
1150791644 17:68204781-68204803 TGGGGCACTGGGAAGGTGGCGGG + Intergenic
1151546438 17:74796162-74796184 TTGTGCCGTTGGTGGGGGGCAGG + Intronic
1151624318 17:75267210-75267232 TCAGGCAGTGTGTGGGAGGCAGG - Intronic
1151788217 17:76287011-76287033 GTGGGCAGGGGGTGGGGGGGCGG - Intronic
1151815181 17:76468247-76468269 CTGTGCAGTGGGTGGGCGCCCGG - Intronic
1151943277 17:77305905-77305927 TGGGGGGGTGGGTGGGTGGGTGG + Intronic
1151973386 17:77470674-77470696 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1152034034 17:77861065-77861087 TTGGTCAATGGGTGGATGGACGG + Intergenic
1152112694 17:78365967-78365989 GCGGGCAGTGGGTAGGTGGGTGG - Intergenic
1152133241 17:78489840-78489862 TGGGTGAGTGGGTGGGTGGGCGG + Intronic
1152141688 17:78540736-78540758 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1152323942 17:79624810-79624832 TGGGGCGGGGGGTGGGGGGCGGG - Intergenic
1152326883 17:79646810-79646832 TGGGGCAGAGGGTGGCTGGCAGG - Intergenic
1152393398 17:80016597-80016619 TGGGACAGAGGGTGGGTGGGTGG + Intronic
1152589683 17:81205396-81205418 CGGGGCAGTGGGTGGGGGGTAGG + Intronic
1152821352 17:82439337-82439359 GTGGACCTTGGGTGGGTGGCCGG - Intronic
1153150687 18:2089463-2089485 GTGGGCAGCGGGTGAGTGGGTGG - Intergenic
1153489593 18:5633101-5633123 TTTGGTAGAGGCTGGGTGGCGGG - Intergenic
1153635590 18:7110174-7110196 TTTGGCAGCGGGTGGGGGGATGG - Intronic
1153698369 18:7666854-7666876 TTTGGCAGGGGGTAGGTGGGAGG + Intronic
1154261253 18:12834927-12834949 TACTGCAGTGGGTGGGGGGCAGG - Intronic
1154299553 18:13181172-13181194 TTGGGGACAGGGTGGGGGGCAGG - Intergenic
1154329992 18:13421692-13421714 CAGGGCGGTGGGTGGGGGGCAGG - Intronic
1154334038 18:13452006-13452028 TTAGGCAGTGTCAGGGTGGCAGG + Intronic
1154377614 18:13822952-13822974 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377666 18:13823114-13823136 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377681 18:13823166-13823188 TGGGTCAGTGGGTGGATGGATGG - Intergenic
1154377700 18:13823226-13823248 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377717 18:13823282-13823304 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1154377732 18:13823329-13823351 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1156268201 18:35507450-35507472 TGGGCCACTGGGTGGGTGGGTGG + Intergenic
1156717069 18:40024205-40024227 TTGGGGGGTGGGGGGGTGGGGGG - Intergenic
1157295306 18:46437884-46437906 GTGGGCAGAGGGTGGGTGGAGGG + Intronic
1158534069 18:58291875-58291897 TTGGGAAGGGGGTGGCTGGAAGG - Intronic
1159353225 18:67300999-67301021 TTGGGCAGGTGGCGGGTAGCTGG - Intergenic
1160328770 18:77973717-77973739 CTGGGCAGGGTGTGGGGGGCAGG + Intergenic
1160414422 18:78698217-78698239 TTAGGCAGTGGCTGTGTGCCGGG - Intergenic
1160526521 18:79541943-79541965 GTGGGTGGTGGGTGGGTGGATGG - Intergenic
1160584204 18:79903799-79903821 GTGGGCAGTGGGGGTGGGGCTGG - Exonic
1160809884 19:1008783-1008805 GTGGGGAGCGGGTGGGCGGCGGG + Intronic
1160871103 19:1278412-1278434 TTGGCCTGTTGGGGGGTGGCAGG + Intronic
1160909703 19:1468942-1468964 CTGGGCAGGGGCTGGGAGGCGGG - Exonic
1160958393 19:1705894-1705916 TGGATGAGTGGGTGGGTGGCTGG + Intergenic
1160960395 19:1718298-1718320 TGGGTGAGTGGGTGGGTGGTGGG + Intergenic
1161009231 19:1952191-1952213 GTGGGCAGTGGGTGCAGGGCTGG + Intronic
1161049879 19:2157597-2157619 TGGGTTAGTGGGTGGGTGGATGG - Intronic
1161227508 19:3153890-3153912 TGGGGGTGTGGGTGGGTGGATGG + Intronic
1161237748 19:3206201-3206223 CAGGCCAGTGGGTGGGTGGGTGG + Intronic
1161287292 19:3475438-3475460 GTGGATAGTGGGTGGGTGGATGG + Intronic
1161347788 19:3776774-3776796 GTGGATAGTGGGTGGGTGGATGG + Intergenic
1161372921 19:3923761-3923783 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1161525222 19:4750582-4750604 AAGGGCAGTGGGTGGGTGAGAGG - Intergenic
1161565488 19:4999817-4999839 TGGGTCGGTGGGTGGGTGGACGG - Intronic
1161565557 19:5000078-5000100 TTGGTAGGTGGGTGGGTGGGTGG - Intronic
1161641116 19:5423908-5423930 TTGGGTGGTGGATGGGTGGATGG - Intergenic
1161680803 19:5678739-5678761 GTGGGGGGTGGGTGGGGGGCGGG + Intronic
1161974377 19:7600283-7600305 TGGGAGAGTGGGTGGGTGGGTGG - Intronic
1161974465 19:7600539-7600561 ATGGGGGGTGGGTGGGTGGATGG - Intronic
1161977606 19:7615141-7615163 TGGGGGAGGGGGTGGCTGGCTGG + Intronic
1162018464 19:7858007-7858029 TGGGGACGTGGGTGGGTGACAGG - Intronic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1162388837 19:10377509-10377531 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1162573966 19:11487882-11487904 GTGGGCAATGGGCTGGTGGCTGG - Exonic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162936961 19:13986213-13986235 GTGGGCAGGGAGTGGGGGGCTGG + Intronic
1162973571 19:14195578-14195600 TTGGGGAGTGGGCAGGAGGCAGG - Intronic
1163462524 19:17447793-17447815 CTTGGAAGTGGGTGGGAGGCGGG - Intronic
1163571231 19:18083587-18083609 TGGGAAAGTGGGTGGGTGGGAGG - Intronic
1163610056 19:18295936-18295958 GTGGTAAGTGGATGGGTGGCTGG - Intergenic
1163767614 19:19172159-19172181 TTGGGGAGTGTGGAGGTGGCTGG + Intronic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1164834825 19:31350074-31350096 TGGGGCAGCTGGGGGGTGGCTGG - Intergenic
1165116970 19:33534321-33534343 TTTGCCAGTGGGTGGGTAGGTGG + Intergenic
1165120594 19:33556249-33556271 TTGAGCAGTGGGCGGGGAGCTGG + Intergenic
1165258108 19:34592192-34592214 TTGGGCAGTGGGAGTGAGGGAGG + Intergenic
1165354781 19:35296870-35296892 GTGGGCAGTGTGTAGGTAGCAGG - Intronic
1165706485 19:37979937-37979959 TTGGGCCCTGGCTGCGTGGCAGG + Intronic
1166060016 19:40320362-40320384 GTGGGCAGGGGCTAGGTGGCTGG - Exonic
1166213884 19:41323620-41323642 TTGGGCAGAGGGGGGCTGGTGGG - Exonic
1166305959 19:41937223-41937245 ATGGGCACTGGTGGGGTGGCTGG - Intergenic
1166395017 19:42433293-42433315 TTGGGCAAGGGTTTGGTGGCAGG + Intronic
1166932155 19:46308055-46308077 TTGCTCAGTGGGTGGATGGATGG + Intronic
1166942248 19:46374100-46374122 CTGGGCTGTGGGTGGGTGTAAGG - Intronic
1167117398 19:47496259-47496281 TTGAGGAGCTGGTGGGTGGCAGG - Intronic
1167308306 19:48721315-48721337 AGGGGTGGTGGGTGGGTGGCTGG + Intronic
1167591321 19:50406020-50406042 TGGGGCTGGGTGTGGGTGGCTGG - Intronic
1167610760 19:50506782-50506804 GTGGACGGTGGGTGGGTGGGTGG - Intronic
1167610768 19:50506801-50506823 GTGGACGGTGGGTGGGTGGGTGG - Intronic
1167610788 19:50506872-50506894 TTGGTAAGTTGGTGGGTGGGTGG - Intronic
1167610809 19:50506950-50506972 TTGGGAAGTTGGCTGGTGGCTGG - Intronic
1167711042 19:51111248-51111270 CTAGACAGTGGGTGGGTGGGGGG - Intergenic
1167959570 19:53095163-53095185 CTGGGCAGTGGGGAGGGGGCGGG - Intronic
1168405500 19:56108306-56108328 CTGGGCAGGGGCTGGGTGGTGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
924979081 2:203884-203906 TTGGGCAGTGGGTTGTGGGGAGG + Intergenic
925347861 2:3183245-3183267 TGGGTGAGTGGGTGGATGGCGGG - Intergenic
925417175 2:3678508-3678530 TTGGGAAATGGATGGATGGCTGG + Exonic
926151856 2:10429709-10429731 TGGGTTGGTGGGTGGGTGGCTGG + Intergenic
927009801 2:18891276-18891298 TTGGGGAGTAGGTAAGTGGCTGG + Intergenic
927213460 2:20652600-20652622 ATGGGGAGTGGGTGGGGGTCTGG + Intergenic
927710768 2:25324599-25324621 TTGGGCAGGGGGTGGGGGTGGGG - Intronic
927868804 2:26610369-26610391 TGGGGCAGTGGGTGGGCAGGGGG - Intronic
928326923 2:30326623-30326645 TGGGGCAGTGGGAAGGTGGGTGG - Intergenic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
928954264 2:36845976-36845998 TTGGGGAGGGGGTGGGAGGGGGG - Exonic
929777726 2:44939085-44939107 TGGGGCAGAGGCTGGGGGGCGGG + Intergenic
929853447 2:45614067-45614089 TTAGGCACTGTGTGGGTGGCGGG - Intergenic
930641610 2:53859606-53859628 AGGGGCGGTGGGTGGGTGGGTGG + Intronic
931429359 2:62196588-62196610 CTGGGCTGAGGTTGGGTGGCTGG - Intronic
931579779 2:63760055-63760077 TTGGGAAGGTGGTGGGAGGCAGG + Intronic
931819960 2:65941954-65941976 TGGGGCAGGGGGCGGGGGGCGGG - Intergenic
932427086 2:71644945-71644967 GTGTGCAGTGGGGGTGTGGCTGG + Intronic
932577937 2:72972933-72972955 TTGGGGAGCTGGAGGGTGGCGGG + Intronic
932751627 2:74375006-74375028 TGGGGCTGTGGGTAGGTGGGTGG - Intronic
933566656 2:83958303-83958325 ATGGGGGGTGGGTGGGTGGGAGG + Intergenic
933786674 2:85848457-85848479 TTAGGCTGGGGGTGGGAGGCGGG - Intronic
933813968 2:86051194-86051216 TTGGACATTTGGTGGGTGGGTGG + Intronic
934035598 2:88086374-88086396 GTGTGCAGTCAGTGGGTGGCAGG + Intronic
934612776 2:95753246-95753268 TTTGCAAGTGGGTGGGTGGCTGG + Intergenic
934648134 2:96071177-96071199 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
934768588 2:96894343-96894365 TGGGTGAGTGGGTGGGTGTCAGG - Intronic
934841513 2:97627007-97627029 TTTGCAAGTGGGTGGGTGGCTGG - Intergenic
935167330 2:100580781-100580803 TTGAGCTGTGGGTGGTTGGCTGG + Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
936873911 2:117165474-117165496 ATGACTAGTGGGTGGGTGGCAGG + Intergenic
937085489 2:119169085-119169107 TTGGGGATTGGCTGAGTGGCTGG - Intergenic
937350267 2:121156014-121156036 TTGGGCACTGGGCAGGTGACCGG - Intergenic
937354815 2:121191642-121191664 AGTGGCAGTGGGTGGGAGGCTGG + Intergenic
937977054 2:127588741-127588763 ATGGGTAGTGGGTGGGTGGATGG + Intronic
937977066 2:127588776-127588798 ATGGGTGGTGGGTGGGTGGATGG + Intronic
937977121 2:127588973-127588995 ATGGGTAGTGGATGGGTGGATGG + Intronic
937977133 2:127589012-127589034 ATGGGTGGTGGGTGGGTGGATGG + Intronic
938246303 2:129780311-129780333 TTTGGCAGAGGCTGTGTGGCCGG - Intergenic
938540395 2:132280163-132280185 TGGGTCAGTGGGTGGCAGGCGGG - Intergenic
938665181 2:133527481-133527503 TTGGGGGGTGGGTGGGTGGAGGG - Intronic
938730205 2:134141501-134141523 TGGGTGGGTGGGTGGGTGGCTGG + Intronic
938756864 2:134388764-134388786 TTGGGGGGTGGGGGGGTGGTCGG + Intronic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
939779217 2:146423781-146423803 GAGGGCTGTGGGTGGGAGGCGGG + Intergenic
939905769 2:147912190-147912212 TTGGGTAGTGGTTTGGGGGCAGG + Intronic
940150663 2:150597147-150597169 TTAGGCTTGGGGTGGGTGGCGGG + Intergenic
940642284 2:156358365-156358387 TTGAGCAGGAGGTGGGTAGCGGG - Intergenic
940868264 2:158838121-158838143 TAGGGAAGTGTGTGTGTGGCAGG + Intronic
941714900 2:168753920-168753942 TTGGGCATGGCGTGGGCGGCAGG - Intronic
942289502 2:174454924-174454946 TTGGGCAGGTAGGGGGTGGCAGG + Intronic
942559129 2:177201671-177201693 TGGGACAGTGGGTGGGGGGATGG + Intergenic
944320831 2:198339819-198339841 TTGGGAACTGGGTAGGTGGGGGG + Intronic
945147411 2:206752926-206752948 AGGGGCAGGGGGTGGGTGGGTGG - Intronic
945688623 2:213005175-213005197 TTTGGGAGTGGTTGGGTGGGGGG + Intronic
946169145 2:217884124-217884146 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
946229316 2:218281948-218281970 ATGGGCATCGGGTGGGTGGGGGG + Exonic
946388655 2:219402022-219402044 GTGTGCAGGGGGTGGGTGGTGGG - Intergenic
947531191 2:230909556-230909578 TTGGGCAGAGGTGGGGTGGTAGG - Exonic
948205558 2:236161111-236161133 TGGGGCAGAGGGAGGGTGGGGGG - Intergenic
948540201 2:238685903-238685925 GTTGGCAGTGGGTGTGGGGCAGG - Intergenic
1168809489 20:695082-695104 GTGGGGAGAGGGTGCGTGGCTGG - Intergenic
1169224726 20:3848833-3848855 TTGGGCACTGGGTGGATGGAAGG - Intronic
1169253858 20:4082882-4082904 TTGGGCAGTGGGTAGGGTTCAGG + Intergenic
1169498505 20:6137014-6137036 TAGGGCAATGGGTGGGTGAATGG - Intergenic
1169809264 20:9592869-9592891 TGTGGCTGTGGGTGGGTGGCTGG + Intronic
1170234325 20:14085023-14085045 TTGGGGGGTGGGGGGGTGGTGGG + Intronic
1170459819 20:16567041-16567063 GTGGGCAGGGGGTGGTTGGAAGG - Intronic
1171010847 20:21508708-21508730 TGGGGCGGGGGGTGGGGGGCGGG + Intergenic
1171486472 20:25489808-25489830 CTGGGCAGAGTGGGGGTGGCGGG - Intronic
1171981344 20:31631514-31631536 TTGGTCTGTGGGTGAGAGGCCGG + Intergenic
1172132220 20:32663673-32663695 TTGGGCTGGGGCTGGATGGCAGG + Intergenic
1172174711 20:32965336-32965358 TGGGTCAGTGGGGAGGTGGCAGG - Intergenic
1172296861 20:33818372-33818394 CTGGGCATTGGATGGGTGGCTGG - Intronic
1172939467 20:38644610-38644632 TGGGTGAGTGGGTGGGTGACGGG - Intronic
1173188887 20:40861509-40861531 AGGGGCAGTGGGTGGGAGGAGGG - Intergenic
1173354036 20:42270273-42270295 TGGGGGGGTGGGTGGGTGGGTGG + Intronic
1173588135 20:44200299-44200321 TTGTGGAATGGGTGGGTAGCAGG - Intronic
1174055326 20:47794596-47794618 GTGGGGAGAGGGTGGGAGGCCGG + Intergenic
1174564507 20:51455709-51455731 TTGGTGGGTGGGTGGGTGGATGG + Intronic
1174670552 20:52303744-52303766 TTTGGCAGTGGGTGGCGGGGGGG - Intergenic
1174708980 20:52685264-52685286 TTGGGGAGTGGGAGTGGGGCGGG - Intergenic
1175094413 20:56530112-56530134 TGGGTTAGTGGGTGGGTGGATGG - Intergenic
1175168064 20:57060283-57060305 TGGGGAAGTGGGTGGGGTGCGGG + Intergenic
1175689393 20:61054660-61054682 TTTGGCAGTGATTGGGTGCCTGG - Intergenic
1175847983 20:62068921-62068943 TTGCGGAGTGGGTGGGGGGAAGG - Intergenic
1175901125 20:62360311-62360333 TAGGGGGGTGGGTGGGTGGATGG + Intronic
1175901170 20:62360430-62360452 TGGGTGAGTGGGTGGGTGGAGGG + Intronic
1175901180 20:62360457-62360479 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1175901190 20:62360484-62360506 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1175901211 20:62360539-62360561 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176411959 21:6453973-6453995 CTGTGCGGTGAGTGGGTGGCGGG - Intergenic
1176849292 21:13900636-13900658 TAGGGTGGTGGGTGGGTGGTGGG - Intergenic
1176870000 21:14076465-14076487 TTGGGCATTTTGCGGGTGGCTGG - Intergenic
1176916347 21:14630194-14630216 TTGAGCTGTGGGTGGGTTCCTGG - Intronic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1178500721 21:33123691-33123713 TTTGTCAGTGGCTGGGTGGAGGG - Intergenic
1178678284 21:34649433-34649455 ATGGGCAGCGGGTTGGGGGCTGG - Intergenic
1179021318 21:37643515-37643537 ATGGGCAAGGGGTGGGTAGCTGG + Intronic
1179079861 21:38160739-38160761 GTTGGCAGTGGTTGGGTGGGGGG + Intronic
1179382685 21:40914050-40914072 GTGGGCTGTGGCTGGGTGGAAGG + Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179687453 21:43062295-43062317 CTGTGCGGTGAGTGGGTGGCGGG - Exonic
1180025156 21:45156603-45156625 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1180144027 21:45909791-45909813 CTGGGCAGTGGGTGGGGGGGGGG - Intronic
1180201705 21:46228643-46228665 TGGGGCAGTGGGCCGGCGGCCGG - Intronic
1180256597 21:46634212-46634234 TTGGGCGGGGGTTGGGGGGCGGG - Intergenic
1180796667 22:18609105-18609127 TTGGACAGAGGTTGGCTGGCAGG + Exonic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181033577 22:20159455-20159477 TTGGCCAGCAGGTGGGGGGCAGG + Intergenic
1181164593 22:20976622-20976644 ATGGGCAGGGGGTGGCAGGCTGG - Intronic
1181225057 22:21386166-21386188 TTGGACAGAGGTTGGCTGGCAGG - Exonic
1181253575 22:21548647-21548669 TTGGACAGAGGTTGGCTGGCAGG + Exonic
1181356116 22:22297400-22297422 GTGGGCGGTGGGGGGGTGGGTGG - Intergenic
1181362792 22:22351497-22351519 TTGGGCTGTGGGTGTGTGCAGGG + Intergenic
1181376130 22:22459707-22459729 TTGAGGAGTAGGTGGGTGGGAGG - Intergenic
1181581787 22:23832780-23832802 TGGGGAGGTGGGAGGGTGGCTGG - Intronic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1181861757 22:25824219-25824241 TTGGGGAGTGAGTGGGAGACAGG + Intronic
1182058928 22:27382691-27382713 GTGGGCAGTGGGTGGGTACTGGG - Intergenic
1182085811 22:27560424-27560446 CTGGGCAGTGAGTGAGTGGGCGG - Intergenic
1182436558 22:30334530-30334552 TGGGGCAGGGGGTGGGAGACAGG + Exonic
1182701023 22:32238535-32238557 TGGAGCAGTGGGTTGCTGGCGGG - Intronic
1183074092 22:35415805-35415827 TGGGGCAGTGGGGTGGTGTCAGG - Intronic
1183338483 22:37264833-37264855 TTGGAAAGTGGGTGTGAGGCTGG - Intergenic
1183341659 22:37284939-37284961 TGGGGCGGTGGGGGGGCGGCGGG + Intronic
1183379516 22:37484038-37484060 TGGGGCAGGGGAGGGGTGGCCGG + Intronic
1183423698 22:37726245-37726267 TAGGTCACTGGGTGGGTGGCGGG - Exonic
1183665080 22:39242428-39242450 TTGGGGAGGGGGTGGCCGGCCGG - Intronic
1183724437 22:39580646-39580668 TGGGGCAGGGGCTGGATGGCAGG + Intronic
1183794921 22:40108929-40108951 GTTGGCTGGGGGTGGGTGGCGGG - Intronic
1183930878 22:41235406-41235428 GTGGGCACTGGGTGTGGGGCAGG + Intronic
1184109754 22:42387802-42387824 GTGGTCAGAGAGTGGGTGGCAGG - Intronic
1184171834 22:42764642-42764664 TGGGGCGGTGGGTCGGTGGGTGG - Intergenic
1184258681 22:43302041-43302063 GTGGGCCGTGGGTGTGTGGGTGG + Intronic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184278074 22:43421621-43421643 CTTGGCAGAGGGTGGGTGTCAGG - Intronic
1184609701 22:45594839-45594861 TTGCTGAGTGGGTGGGTGGATGG + Intronic
1184653362 22:45929424-45929446 TGGATCAGTGGGTGGGTGGATGG - Intronic
1184653373 22:45929488-45929510 TTGGTGGGTGGGTGGGTGGGTGG - Intronic
1184730428 22:46368516-46368538 TTGCGCAGGGGCTGGGTGTCAGG - Intronic
1185116535 22:48941305-48941327 GGGGGCAGTGGGTGGGGGGCGGG + Intergenic
1185173794 22:49307753-49307775 TTGCTCATCGGGTGGGTGGCAGG - Intergenic
950096078 3:10331432-10331454 TGGGGCAGGGGGATGGTGGCAGG + Intronic
950203032 3:11057985-11058007 TAGGTGAGTGGGTGGGTGGGTGG + Intergenic
950485374 3:13270184-13270206 TTGGGCAGTGCTTGGCTGGGTGG - Intergenic
950542426 3:13620396-13620418 ATGGGGAGTGGGAGGGAGGCTGG + Intronic
950928152 3:16763816-16763838 ATGGCCCGTGGGTGTGTGGCAGG + Intergenic
951235829 3:20235371-20235393 TGGGGAAGAGGGTGGGTGGATGG + Intergenic
951444376 3:22761273-22761295 ATGTGCAGTGGGAGCGTGGCTGG - Intergenic
951821587 3:26819842-26819864 TTGGGCAGAGGGAGGTTGGGAGG - Intergenic
952520325 3:34150373-34150395 TTGTGCAGGGAGTGGGGGGCAGG + Intergenic
952562223 3:34608506-34608528 TTTGGCTGGGGGTGGGTGGTAGG + Intergenic
952772408 3:37014185-37014207 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
952934225 3:38383106-38383128 TTGGGCACTGAGTGTGTGCCCGG + Intronic
953566181 3:44033739-44033761 TTGGTGGGTGGGTGGGTGGGTGG + Intergenic
953800639 3:46020005-46020027 TTGGAGTGTGGGTGGGTGGGGGG + Exonic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
954136334 3:48583823-48583845 TGGGGCAGTGGTTGGGTGCTGGG - Intronic
954420155 3:50414549-50414571 GAGGGCAGTGGAAGGGTGGCAGG + Intronic
954699621 3:52444353-52444375 TCGGGGAGTGGGAGGGAGGCAGG - Intronic
955102031 3:55859676-55859698 TGGGGATGTGGGTGGGTGGGAGG - Intronic
955880871 3:63543912-63543934 TTGGGAATAAGGTGGGTGGCGGG + Intronic
955932642 3:64073040-64073062 TTGAGCAGTGGGTGGGGGAGAGG + Intergenic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
956451025 3:69375032-69375054 TGGGTAAGTGGGTGGGTGGGTGG - Intronic
956762929 3:72459482-72459504 TGGGGCTGTGGGAAGGTGGCCGG + Intergenic
957437928 3:80203122-80203144 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
958659511 3:97048270-97048292 TTGGGCAGTGGCTTGTTGGAAGG + Intronic
958734088 3:97989336-97989358 GTGGTCAGTGGGTGAGTGGGTGG + Intronic
959649413 3:108737236-108737258 GAGGGGAGTGGGTGGGTGGGTGG - Intergenic
960197280 3:114784443-114784465 TTGGGCAGTGGATCAGTGGCTGG - Intronic
960353481 3:116622169-116622191 ATGGGCAGCTGGTGGTTGGCTGG - Intronic
960454146 3:117849590-117849612 ATGGGCAATGGCTGGGTGCCTGG + Intergenic
960463021 3:117960156-117960178 TTGGGAAGTGGGTGGTGGGGGGG - Intergenic
961315257 3:126030712-126030734 TAGGTCGGTGGGTGAGTGGCTGG + Intronic
961384301 3:126515738-126515760 TTGGGGAGAGGGTAGGTGGTGGG - Intronic
961384339 3:126515835-126515857 TTGGGGAGAGGGTAGGTGGTGGG - Intronic
962249511 3:133827101-133827123 CTAGGCAGAGGGTGTGTGGCAGG + Exonic
962342327 3:134596053-134596075 TTGGTCTCTGGGTGGGTGGGTGG + Intergenic
963140167 3:141940419-141940441 TTGGGGAGGGTGTGGGTGGTGGG - Intergenic
963286883 3:143442049-143442071 TTGATGAGTGGGTGGGTGGATGG - Intronic
963602435 3:147390174-147390196 TTCAGCAGGGGGTGGGTGGGTGG - Intronic
964670147 3:159216087-159216109 TGGGGCGGGGGGTGGGTGGATGG + Intronic
964808709 3:160639599-160639621 TGGGGCAGTGGGTGGGGAGTAGG - Intergenic
965715202 3:171595300-171595322 TTTGGCAGTTGGTGGCTGGTGGG + Intergenic
965722639 3:171678647-171678669 TGGGACAGTGTGTTGGTGGCAGG - Intronic
965821714 3:172691017-172691039 TTGGGCAGTGTGTGGATGTCAGG - Intronic
965951199 3:174310002-174310024 TTGGGCAGTGGCCAAGTGGCAGG - Intergenic
966239906 3:177744603-177744625 TTTGGCAATGGGTGGATGGGAGG + Intergenic
966743450 3:183254248-183254270 TTGGGCCGGGGGCGCGTGGCTGG + Intronic
967779491 3:193419835-193419857 AGGGGCAGTGGGTGGGGGACAGG - Intronic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968531271 4:1093026-1093048 TAGGGCAGAGGCTGGGTGGATGG + Intronic
968647477 4:1747915-1747937 CTGGGCAGTGGGTGGGCACCAGG - Intergenic
968823543 4:2875693-2875715 TTGGTTAGTGGGAGGGTGGGAGG + Intronic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
968924780 4:3541493-3541515 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
968928151 4:3560809-3560831 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
968983947 4:3865389-3865411 CGAGGCAGTGGGTGGGGGGCGGG - Intergenic
969043071 4:4316235-4316257 ATGGGAAGAGGGAGGGTGGCTGG + Intronic
969424891 4:7118395-7118417 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424927 4:7118582-7118604 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424938 4:7118625-7118647 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969424970 4:7118773-7118795 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969499420 4:7543872-7543894 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
969500444 4:7549412-7549434 TGGGGCATTGGGTGGGGGACTGG + Intronic
969524089 4:7695437-7695459 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524137 4:7695585-7695607 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524198 4:7695793-7695815 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969524241 4:7695925-7695947 TTGGTGGGTGGGTGGGTGGATGG + Intronic
969640446 4:8395247-8395269 TGGGGGGGTGGGTGGGTGGGTGG + Intronic
969929639 4:10618356-10618378 TGGGGAAGTGGGTGGGGGACTGG + Intronic
971280246 4:25237358-25237380 TTTGGCAGTGGGTGGCTGTAGGG + Intronic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
972302088 4:37794009-37794031 GTGAGCAGTGGGTGGTTGGGTGG - Intergenic
972442397 4:39107391-39107413 TAGGTCGGTGGGTGGGTGGGTGG - Intronic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
972944351 4:44236129-44236151 TTGGGCAGTGGCTGAGTTGCTGG - Intronic
973551863 4:52043617-52043639 TTGGGAACTGAGTGGGAGGCAGG - Intergenic
973572745 4:52257118-52257140 TTGTGCATTGCATGGGTGGCAGG + Intergenic
973722996 4:53744029-53744051 TTGGGCAGGTGGTGGGGAGCAGG + Intronic
975131797 4:70839214-70839236 TTGGGCAGTGTAAGTGTGGCTGG - Intronic
975180488 4:71338907-71338929 TTGGACAGAGGGAGGGTGGGTGG + Intronic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
976656823 4:87497408-87497430 TTGGGCAGTAGGCGGATGGAGGG - Intronic
978230478 4:106391857-106391879 ATGGGAGGTGGGTGGGTGGGAGG - Intergenic
978306887 4:107338940-107338962 TTGGGAAGTGGTGGGGTGGGGGG - Intergenic
978328394 4:107585186-107585208 TTGGGCAGGGGGTCGGGGGAGGG + Intergenic
979610656 4:122685557-122685579 AAAGGCAGTGGGTGGGTGGGTGG + Intergenic
979768926 4:124498387-124498409 TGGTGAAGTGGGTGGGTGGATGG + Intergenic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
982091774 4:151885712-151885734 TGGAGCAGTCGTTGGGTGGCAGG - Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982760595 4:159278482-159278504 TTTAGCAGTGGGTGGAAGGCGGG + Intronic
985102261 4:186470305-186470327 TTGGGAGGTGGGAGGGTGGGTGG + Intronic
985190987 4:187372645-187372667 TTGGCTAGTGGGTAGGAGGCAGG + Intergenic
985560568 5:584059-584081 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
985560609 5:584187-584209 TGGGTAAGTGGGTGGGTGGATGG + Intergenic
985590538 5:762209-762231 CTGGGCTGTGAGTGGCTGGCCGG - Intronic
985837281 5:2280640-2280662 ATGGGCAGGGGATGGGTGGGCGG + Intergenic
986007876 5:3683380-3683402 TTAGGTAGTGGGAGGGTGGGAGG + Intergenic
986105858 5:4658739-4658761 TTGGGCAGTTGTTTGGAGGCTGG + Intergenic
986188364 5:5467342-5467364 TTCAGCAGTTGGTGGGTGGTGGG + Intronic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
988322534 5:29717749-29717771 TGGGTCAGGGGGTGGATGGCAGG + Intergenic
988739144 5:34052699-34052721 TTTGACAGTGAGTGGGTGCCAGG - Intronic
988989054 5:36651535-36651557 TTGGGCTGGGGGTGGGAGGGTGG - Intronic
989191776 5:38677265-38677287 TGGGGCAAGGGATGGGTGGCGGG + Intergenic
989661649 5:43805456-43805478 TTGGGCAGTGGTTGGGGGTGTGG + Intergenic
990381241 5:55223477-55223499 TTAGCTAGTTGGTGGGTGGCGGG - Intronic
990466865 5:56078934-56078956 TTAGGGAGGGGGTGGGAGGCTGG + Intergenic
991419390 5:66426021-66426043 AAGGGTAGTGGGTGGGTGGTAGG + Intergenic
991600073 5:68343348-68343370 GTGGGCAGTGGGTGGGAGTTGGG - Intergenic
991920498 5:71651762-71651784 TTGGGGTGTGGGTGTGTGGGTGG + Intronic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
992265688 5:75016142-75016164 GTGGGGGGTGGGTGGGTGGGTGG + Intergenic
993864504 5:93176239-93176261 TGGGGCTGGGGGTGGGTGGGTGG - Intergenic
994090299 5:95803858-95803880 TTGGGCAATGTGAGGGAGGCTGG + Intronic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
995585398 5:113643180-113643202 TTTGTCAGGGGGTGGGGGGCAGG + Intergenic
996738001 5:126775334-126775356 TTGGGGGGTGGGGGGGTGGGGGG - Intergenic
996809907 5:127505120-127505142 GTGGGCAGTGGGGCAGTGGCCGG + Intergenic
997194118 5:131966360-131966382 TTTGGCAGTGGGAGGGTGTGTGG - Intronic
997372707 5:133372053-133372075 TCGGCCTGTGGGTGGGTGACAGG - Intronic
998057149 5:139087919-139087941 CCTGGCTGTGGGTGGGTGGCTGG - Intronic
998138847 5:139688749-139688771 ATGGGCTGGGGGTGGGGGGCGGG - Intergenic
998806498 5:145922172-145922194 CTGGGCAGAGGGTGTGTGGCAGG - Intergenic
998946941 5:147350156-147350178 GGGGGCGGTGGGTGGGGGGCGGG - Intronic
999237713 5:150109055-150109077 TTGGGTGGTGGGGGGGGGGCGGG - Intronic
999305470 5:150516618-150516640 TAGGTCTGTGGATGGGTGGCAGG + Intronic
999306479 5:150522676-150522698 TTTGGGAGTGGGTGGGTGACAGG + Intronic
1000463175 5:161547214-161547236 TTGTGCAGCGGGTGGGAGGAGGG + Intronic
1001329822 5:170754320-170754342 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001329895 5:170754572-170754594 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001589282 5:172854530-172854552 TTGGGATGTGGGTAGGTGGGTGG - Intronic
1001847052 5:174931381-174931403 TTGGATAGTGGGGGGGTGGAAGG + Intergenic
1002528934 5:179832227-179832249 TTGGGGAGTGGGATGGGGGCAGG + Intronic
1002601673 5:180357183-180357205 GTGGGCAGTGGGTGGGGTTCAGG + Intergenic
1003667973 6:8129227-8129249 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1003934117 6:10957857-10957879 GTGGACTGTGGGTTGGTGGCCGG + Intronic
1004039158 6:11958946-11958968 TTGAGCAATGGGTGGATGGCTGG - Intergenic
1004397284 6:15256580-15256602 GTGTGAAGTGGATGGGTGGCAGG - Intronic
1005401165 6:25436193-25436215 TTGGGGAGTGTGTGGGTTGTTGG + Intronic
1005914658 6:30341914-30341936 CTGGGCAGTGGGTGTATGCCGGG + Exonic
1006079468 6:31557007-31557029 TTGGGCACTGCCTTGGTGGCTGG + Intronic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1006401684 6:33821479-33821501 CTGGCCTGGGGGTGGGTGGCAGG - Intergenic
1007237213 6:40399311-40399333 GGGAGCAGTGGGTGGGGGGCAGG - Intronic
1007249507 6:40486200-40486222 GTGGGCAGTGGGAGTGGGGCTGG + Intronic
1007724472 6:43906741-43906763 TTTGGCAGTGTGTGGGAGGCGGG + Intergenic
1012225430 6:96698251-96698273 AAGGGTAGTGGGTTGGTGGCAGG + Intergenic
1014752092 6:125268178-125268200 GTGGGCAGGTGGTGGGTAGCTGG - Intronic
1014920842 6:127213354-127213376 TTGGGCAGGGGGAGGGTCACGGG + Intergenic
1015548320 6:134385535-134385557 TTGCCCCGTGGGAGGGTGGCTGG + Intergenic
1016652454 6:146478348-146478370 TTGAGCAGAGGGTGGGAGGAGGG - Intergenic
1016658288 6:146544776-146544798 TTGAGGAGTGGGGGGGGGGCGGG - Intronic
1016681371 6:146833194-146833216 TTGTGTGTTGGGTGGGTGGCAGG - Intergenic
1016705884 6:147107124-147107146 TGGGGCAGTGGGTGGGTGCAGGG + Intergenic
1017446092 6:154509301-154509323 TGGGGCGGTGGGGGGGTGGTGGG - Intronic
1017821696 6:158053769-158053791 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1018065460 6:160122453-160122475 TTGTGCAGTTCGTGGGTGTCTGG + Intronic
1018421187 6:163642253-163642275 TTGGGCAGTGGGTTGATGGTGGG + Intergenic
1018677558 6:166236113-166236135 GTGGGCAGGGGGTGGGGGGGGGG - Intergenic
1018924990 6:168199563-168199585 TGGGCGAGTGGGTGGGTGGATGG + Intergenic
1019173924 6:170150222-170150244 GTAGGCAGTGGAGGGGTGGCAGG - Intergenic
1019287401 7:230504-230526 TGGGGCCGTGGGTGGATGGAGGG + Intronic
1019510663 7:1415858-1415880 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1019510703 7:1415985-1416007 TGGGTAGGTGGGTGGGTGGCTGG + Intergenic
1019510733 7:1416089-1416111 TGGGTAGGTGGGTGGGTGGCTGG + Intergenic
1019704588 7:2491446-2491468 TTGGGGGATGGGTGGGTGGATGG - Intergenic
1019704720 7:2492048-2492070 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1019751096 7:2730327-2730349 TTGGGCAGTGGGTGGCTAAGGGG + Exonic
1019848149 7:3527540-3527562 TTGGCTAGTGGGTGAGTGGTAGG + Intronic
1020803064 7:12756046-12756068 ATGGGGAGTGGGTGGGTGGGAGG + Intergenic
1020890528 7:13872365-13872387 TTGGTGGGTGGGTGGGTGGGGGG - Intergenic
1021654253 7:22859341-22859363 TTTGGTAGTGGGGGAGTGGCAGG - Intergenic
1021802891 7:24325574-24325596 TTTGGGGGTGGGTGGGTGGGTGG - Intergenic
1022378718 7:29840139-29840161 TACTGCAGTGGGTGGGTGGTGGG - Intronic
1022531884 7:31071999-31072021 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1022603233 7:31781695-31781717 TAGGGCAGTGTGTGGGGGGTGGG - Intronic
1023873827 7:44276427-44276449 TTGTGCAGTGGGTGGCGGGGGGG - Intronic
1024242499 7:47446508-47446530 CTGGGCAGAGGCTGGGTGGGAGG - Intronic
1024529054 7:50375708-50375730 TTGGGTGGTGGGTGGGGGGGGGG - Intronic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1025237665 7:57245546-57245568 GTGGGGAGAGGGTGGGAGGCTGG - Intergenic
1026103787 7:67404609-67404631 CTGGTGAGTGGGTGGGTGGGTGG + Intergenic
1026802285 7:73407904-73407926 GTGGGCAGTGGGGGGGTTGGCGG + Intergenic
1026873420 7:73866820-73866842 TTGATCAGTGGGTGGGTAGATGG - Intergenic
1026973009 7:74479346-74479368 TGTGGGAGTGGGTGGGTGGGTGG - Intronic
1027050572 7:75018980-75019002 CTGGACAGTGGGTGGATGACTGG - Exonic
1027445491 7:78268933-78268955 CTTGTCAGTGGGTGGGGGGCTGG - Intronic
1027684899 7:81267498-81267520 GTGGGCAGGTGGTGGGTAGCTGG + Intergenic
1028841221 7:95431983-95432005 TGGGGTAGGTGGTGGGTGGCTGG - Intronic
1029195443 7:98802347-98802369 GAGGGGAGTGTGTGGGTGGCAGG + Intergenic
1029382478 7:100222690-100222712 CTGGACAGTGGGTGGATGACCGG + Intronic
1029998713 7:105034853-105034875 TTGGGGGGTGGGGGGGTGGGGGG + Intronic
1030161404 7:106512155-106512177 TGGGGAAGTGGGCAGGTGGCTGG - Intergenic
1030498894 7:110334358-110334380 TGGGGCAGAGGGTTGGTGGAAGG - Intergenic
1031361860 7:120857493-120857515 TGGGACAGTGGGCGGGGGGCGGG + Intronic
1031407653 7:121405664-121405686 TGGGGCGGTGGGTGGGGGGCGGG + Intergenic
1031664944 7:124472413-124472435 CAGGGCAGAGGGTGGGTGGTAGG + Intergenic
1032578471 7:133081369-133081391 GTGGGGAGTGGGTGGGAGGAGGG + Intronic
1032803722 7:135336328-135336350 GTGGTGAATGGGTGGGTGGCTGG - Intergenic
1033076942 7:138258539-138258561 TTGGTGGGTGGGTGGGTGGGGGG - Intergenic
1033137674 7:138798341-138798363 TTAGGCAGGGGGTGGGAGGTGGG + Intronic
1033674823 7:143530443-143530465 TGGAGCAGTGGGTGCGTGACCGG + Intergenic
1033697013 7:143798997-143799019 TGGAGCAGTGGGTGCGTGACCGG - Intergenic
1033769047 7:144527935-144527957 GAGGGCAGAGGGTGGGAGGCGGG + Intronic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034210781 7:149360203-149360225 TGGGGCAGTGGGTGGGTGGGTGG - Intergenic
1034412988 7:150950882-150950904 GTGGCCAGTGGGTGGCAGGCTGG - Intronic
1034606222 7:152318432-152318454 ATGGGGAGGGGGTGGGTGGGTGG - Intronic
1035108271 7:156459870-156459892 TGTGGCAGTGGGTGGCAGGCAGG - Intergenic
1035286116 7:157808247-157808269 TAGGTGAGTGGGTGAGTGGCGGG + Intronic
1035318578 7:158013800-158013822 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1035318593 7:158013844-158013866 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318638 7:158014036-158014058 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035347443 7:158212716-158212738 TAGAGGAGTGGGTGAGTGGCGGG - Intronic
1035600672 8:895016-895038 TGGGGGAGTGGGGTGGTGGCTGG + Intergenic
1035715400 8:1750491-1750513 TTGGGGAGTGTGTGTGTGTCAGG - Intergenic
1036282951 8:7417191-7417213 GTGGGCAGCAGGTGAGTGGCAGG - Intergenic
1036338517 8:7894327-7894349 GTGGGCAGCAGGTGAGTGGCAGG + Intergenic
1036621148 8:10425131-10425153 TTTGGCGGTGGGTGGGGGGATGG + Intronic
1036777286 8:11622369-11622391 GTTGGCAGTGAGGGGGTGGCAGG - Intergenic
1037855366 8:22367472-22367494 TGGGGCAGTGGGTGGGGGCGGGG + Intronic
1037924344 8:22832862-22832884 GGGGGCTGTGGGTGGGTGGCTGG - Intronic
1037985722 8:23289399-23289421 TTAAGTAGTGGGTGTGTGGCGGG + Intronic
1037986099 8:23291605-23291627 TTAGGCACTGGGTGTGGGGCAGG - Intronic
1037987085 8:23296752-23296774 AGTGGCAGTGGGGGGGTGGCTGG - Intergenic
1039058773 8:33557116-33557138 TTTGGTAATGTGTGGGTGGCGGG + Intronic
1039434114 8:37547869-37547891 CTGGGCAGTTGCTGGCTGGCTGG + Intergenic
1039575797 8:38623098-38623120 GTGTGCACTGGATGGGTGGCTGG + Intergenic
1040969098 8:53114503-53114525 GTGGGCAGTGGGCTGGGGGCTGG - Intergenic
1041024011 8:53665899-53665921 TGGGGAAGTGGGAGGGTGGAGGG - Intergenic
1041238383 8:55827653-55827675 TGGGGCGGGGGGTGGGGGGCCGG - Intergenic
1042077337 8:65010462-65010484 TGGTGCTGTGTGTGGGTGGCAGG - Intergenic
1042108585 8:65355527-65355549 TTGGGCAGGGGGTGGGTAGCTGG + Intergenic
1043401541 8:79890090-79890112 TGGGGCTGTGGGTGGGTGGGAGG + Intergenic
1044427807 8:92073370-92073392 TAGGGCAGAGGCTGGGGGGCAGG - Intronic
1044575992 8:93769345-93769367 TTGGGCAGTATGTGGGATGCAGG - Intronic
1045557481 8:103228690-103228712 ATGGGCAGTGGGTTGGTGCATGG - Exonic
1048056820 8:130874852-130874874 TGGGGGTGTGGGTGGGGGGCTGG - Intronic
1048204970 8:132408068-132408090 TTAGGTGGTGGGTGGGTGGGTGG - Intronic
1049418183 8:142505056-142505078 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
1049464617 8:142745079-142745101 ATGGGCAGAGGATGGGTGGGTGG + Intergenic
1049551111 8:143260362-143260384 TGGGGCAGTGGGCGCGGGGCGGG + Intronic
1049604911 8:143524817-143524839 TGGGGCAGAGCGTGGCTGGCAGG - Intronic
1049641116 8:143716433-143716455 TCGGGCAGGGGGTGAGTGCCTGG + Exonic
1049795348 8:144494802-144494824 GTGGGCTGTGAGTGGCTGGCAGG + Intronic
1050457293 9:5846302-5846324 TGGGCCACTGGGTGGGTGGCGGG - Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1051641450 9:19228564-19228586 GTGGGGTGTGGGTGGGTGGTTGG + Intergenic
1051644987 9:19259238-19259260 AAGGGCAGTGGGGAGGTGGCGGG - Intronic
1052536017 9:29748411-29748433 TTGGGGAGTGGGTGGGGAGAGGG + Intergenic
1052676882 9:31637733-31637755 TTTGGGAGTGGGCGTGTGGCAGG - Intergenic
1052912676 9:33897725-33897747 TTGGGCAGTGAATGCGTGGGAGG - Intronic
1052989114 9:34508338-34508360 TGGGGCAGAGGGTGGGAGGGAGG + Intronic
1053591842 9:39522137-39522159 TTGGGTGATGGGTGGGTGACGGG + Intergenic
1053786399 9:41655560-41655582 TTGGGGAGGGGGTGGGGGACAGG + Intergenic
1053799853 9:41757468-41757490 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1053803020 9:41775919-41775941 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
1054142243 9:61539203-61539225 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054145358 9:61557465-61557487 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1054188261 9:61969522-61969544 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1054191309 9:61987229-61987251 TAGGTGAGTGGGTGGGTGGATGG - Intergenic
1054461991 9:65470350-65470372 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054574463 9:66843152-66843174 TTGGGTGATGGGTGGGTGACGGG - Intergenic
1054647060 9:67600488-67600510 TAGGTGAGTGGGTGGGTGGATGG + Intergenic
1054650253 9:67619054-67619076 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1054705401 9:68456305-68456327 TTTGGGGGTGGGGGGGTGGCAGG + Intronic
1056282256 9:85052919-85052941 TTGGGTGGTGGGTGGGGGTCAGG + Intergenic
1056682272 9:88730319-88730341 TTGGTGAGTTGGTGGGTGGATGG - Intergenic
1056710545 9:88989490-88989512 TGGGGCAGTGGGTGAGTGAGAGG + Intergenic
1056857405 9:90144511-90144533 AGGGGCAATGGGTGGGGGGCAGG - Intergenic
1056983657 9:91341189-91341211 GTGGGCAGTGGGAGGCTGGAAGG - Intronic
1057422939 9:94926794-94926816 TGGGGCCGGGGGTGGGTTGCGGG + Intronic
1057806992 9:98226419-98226441 TTGGGCAGCTGCTGGGTGCCAGG + Intronic
1058131098 9:101254479-101254501 CTGGGCAGGAGGTGAGTGGCAGG - Intronic
1058467830 9:105245609-105245631 TTGGGCACCTGGTGGGTGACGGG + Intronic
1058703021 9:107616294-107616316 TTGGTGGGTGGGTGGGTGGATGG - Intergenic
1058878049 9:109261102-109261124 TTGCTAAGTGGGTGAGTGGCCGG + Intronic
1059498585 9:114731113-114731135 GTGGGGGGTGGGTGGGTGGGTGG - Intergenic
1060228178 9:121808879-121808901 TGGGGCAGGGGGAGGCTGGCAGG - Intergenic
1060385763 9:123226755-123226777 TTGGGGAGTGAGGGGGTGGCGGG + Intronic
1060428653 9:123527715-123527737 TTGGGCACTGGGTTGATGGCAGG - Intronic
1060889128 9:127177181-127177203 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1060896048 9:127218305-127218327 GTGTGCAGAGGGTGGGTGGCTGG - Intronic
1061398679 9:130356887-130356909 TAGATCAGTGGGTGGGTGGATGG + Intronic
1061843239 9:133372422-133372444 ATGGGCAGAGGGAGGTTGGCTGG - Intronic
1061932092 9:133838500-133838522 TGGGTAAGTGGGTGGGTGGGTGG + Intronic
1061932171 9:133838824-133838846 TTGGTGAGTGGGTTGGTGGATGG + Intronic
1062002843 9:134225461-134225483 CTGGGCAGTGGGAGGTGGGCAGG + Intergenic
1062022735 9:134326863-134326885 CTGGGCAGCGGGCGGGCGGCGGG + Intronic
1062089687 9:134668987-134669009 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1062312885 9:135948744-135948766 TTTGGGACTGGGTGGCTGGCTGG - Intronic
1062514950 9:136928389-136928411 GTGGGAAGTGGGTTGGTGGGTGG + Intronic
1062520765 9:136956982-136957004 TTGGATATTGGGTGGGTGGGTGG + Intronic
1062520788 9:136957070-136957092 TTGGATATTGGGTGGGTGGGTGG + Intronic
1062520861 9:136957313-136957335 TTGGATAATGGGTGGGTGGGTGG + Intronic
1062520902 9:136957451-136957473 TTGGATGGTGGGTGGGTGGATGG + Intronic
1062540518 9:137039885-137039907 CTGGGCAGTGGGTGGGCTGGGGG + Intronic
1062565435 9:137162089-137162111 GTGGGCAGGGGCCGGGTGGCGGG + Intronic
1062649920 9:137570129-137570151 ATGGGTGGTGGGTGGGTGGGTGG - Intronic
1185495307 X:550067-550089 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185616405 X:1424580-1424602 TGGGTGAGTGGATGGGTGGCTGG - Intronic
1185624438 X:1472572-1472594 TGGGTGAGTGGGTGGATGGCTGG + Intronic
1185624552 X:1473034-1473056 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1185624630 X:1473366-1473388 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185624735 X:1473809-1473831 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185759639 X:2680746-2680768 TTGGTGAATGGGTGGGTGGGTGG - Intergenic
1185759651 X:2680818-2680840 TTGGTGAATGGGTGGGTGGGTGG - Intergenic
1185867972 X:3639565-3639587 TTGGGGGGTAGGTGGGTGGATGG + Intronic
1185883270 X:3759252-3759274 TGGGTGAGTGGATGGGTGGCTGG - Intergenic
1186054673 X:5636653-5636675 TTTGGCAATAGGTGAGTGGCAGG - Intergenic
1186601622 X:11043926-11043948 AAGGGTAGTGGGTGGGTGGGTGG - Intergenic
1186822131 X:13300306-13300328 TTGGGATGGGGGTGGGTGGAAGG - Intergenic
1187156439 X:16724452-16724474 TTGGCCACTGGCTGGGTGTCCGG - Intronic
1187305766 X:18093900-18093922 TTGGTCAGTGGGTTGCTGGGGGG + Intergenic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1188395701 X:29680540-29680562 TGTGGCAGTTGGTGGGTGGGTGG + Intronic
1189231601 X:39456184-39456206 CGGGGCAGCGGGTGGGTGGGGGG + Intergenic
1189745413 X:44163315-44163337 TTAAGAAGTGGGTGGGTGGGTGG - Intronic
1190888926 X:54552320-54552342 GTGGGCAGAGTGTGAGTGGCTGG - Exonic
1192054420 X:67758784-67758806 CTGGGGTGTGGGTGGGGGGCTGG + Intergenic
1192338165 X:70239140-70239162 TCAGGCAGTGAGTGAGTGGCAGG - Intronic
1192536977 X:71936402-71936424 TTAGGCAGTGGGTCAGTGGATGG + Intergenic
1192551811 X:72060685-72060707 TTGGGCAGTGGGCAGGGAGCTGG - Intergenic
1193777634 X:85663189-85663211 TTGGGGGGTGGGGGGGTGGGGGG + Intergenic
1194635988 X:96345514-96345536 TGGGGCGGTGGGTGGGGGGAGGG - Intergenic
1194902156 X:99525656-99525678 AAGGGCAGTGGGTGGTTGGTGGG + Intergenic
1196419543 X:115507964-115507986 TTGGGCAGCGGGTGGCAGGGAGG - Intergenic
1197178977 X:123513911-123513933 GTGGGAAGCGGGTGGGAGGCAGG - Intergenic
1197746224 X:129933261-129933283 TTGGCATGTGGGTGGGTGGCTGG - Intergenic
1198225272 X:134639440-134639462 TTGGGGAGTGGTGGGGTGGTGGG + Intronic
1198369153 X:135974153-135974175 GGGGCCAGTGGGTGGGTGGGTGG + Intergenic
1198540970 X:137639433-137639455 TTGGGGCGAGGGTGGGTGGAAGG + Intergenic
1198774489 X:140165056-140165078 TGGGGGAGTGGGTGGGAGGGAGG + Intergenic
1199428877 X:147736176-147736198 TGGGGCGGTGGGGGGGTGGTTGG - Intergenic
1200090654 X:153634362-153634384 TGGGGCAGTGGGTGGGGAGTGGG - Intergenic
1202119572 Y:21509307-21509329 GTGGGCAGGGGGTTGGGGGCGGG + Intergenic
1202122024 Y:21532847-21532869 GTGGGCAGGGGGTTGGGGGCGGG + Intronic
1202156982 Y:21896535-21896557 GTGGGCAGGGGGTTGGGGGCGGG - Intronic
1202159428 Y:21920076-21920098 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202185876 Y:22184991-22185013 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202205484 Y:22401405-22401427 GTGGGCAGGGGGTTGGGGGCGGG + Intronic