ID: 1122790754

View in Genome Browser
Species Human (GRCh38)
Location 14:104183212-104183234
Sequence ACGTGGAATCCACTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122790744_1122790754 24 Left 1122790744 14:104183165-104183187 CCCACAGTTCAGGCCTGGCTCTC No data
Right 1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG No data
1122790742_1122790754 30 Left 1122790742 14:104183159-104183181 CCATTTCCCACAGTTCAGGCCTG No data
Right 1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG No data
1122790751_1122790754 -10 Left 1122790751 14:104183199-104183221 CCTGTTTTACAGGACGTGGAATC No data
Right 1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG No data
1122790748_1122790754 11 Left 1122790748 14:104183178-104183200 CCTGGCTCTCAGAGGGCAGTGCC No data
Right 1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG No data
1122790745_1122790754 23 Left 1122790745 14:104183166-104183188 CCACAGTTCAGGCCTGGCTCTCA No data
Right 1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122790754 Original CRISPR ACGTGGAATCCACTGTCTTG GGG Intergenic
No off target data available for this crispr