ID: 1122792250

View in Genome Browser
Species Human (GRCh38)
Location 14:104188977-104188999
Sequence CCGGAGGAGTTCCCTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122792237_1122792250 7 Left 1122792237 14:104188947-104188969 CCCCAGCTCTGCCACTTCCCACC No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792236_1122792250 11 Left 1122792236 14:104188943-104188965 CCAACCCCAGCTCTGCCACTTCC No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792238_1122792250 6 Left 1122792238 14:104188948-104188970 CCCAGCTCTGCCACTTCCCACCT No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792242_1122792250 -4 Left 1122792242 14:104188958-104188980 CCACTTCCCACCTGGGCTGCCGG No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792235_1122792250 19 Left 1122792235 14:104188935-104188957 CCTGGGTTCCAACCCCAGCTCTG No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792239_1122792250 5 Left 1122792239 14:104188949-104188971 CCAGCTCTGCCACTTCCCACCTG No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data
1122792245_1122792250 -10 Left 1122792245 14:104188964-104188986 CCCACCTGGGCTGCCGGAGGAGT No data
Right 1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122792250 Original CRISPR CCGGAGGAGTTCCCTGAGAT GGG Intergenic
No off target data available for this crispr