ID: 1122794992

View in Genome Browser
Species Human (GRCh38)
Location 14:104201582-104201604
Sequence GAGGCAGAAAAGGGGTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794992_1122794998 0 Left 1122794992 14:104201582-104201604 CCGCCACACCCCTTTTCTGCCTC No data
Right 1122794998 14:104201605-104201627 AGTCCACGTGCCGCCGATACAGG No data
1122794992_1122795003 15 Left 1122794992 14:104201582-104201604 CCGCCACACCCCTTTTCTGCCTC No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data
1122794992_1122795001 10 Left 1122794992 14:104201582-104201604 CCGCCACACCCCTTTTCTGCCTC No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794992_1122795004 27 Left 1122794992 14:104201582-104201604 CCGCCACACCCCTTTTCTGCCTC No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794992 Original CRISPR GAGGCAGAAAAGGGGTGTGG CGG (reversed) Intergenic