ID: 1122794993

View in Genome Browser
Species Human (GRCh38)
Location 14:104201585-104201607
Sequence ACTGAGGCAGAAAAGGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794993_1122795004 24 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122794993_1122795001 7 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794993_1122795005 30 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG 0: 1
1: 0
2: 1
3: 33
4: 256
1122794993_1122794998 -3 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122794998 14:104201605-104201627 AGTCCACGTGCCGCCGATACAGG No data
1122794993_1122795003 12 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794993 Original CRISPR ACTGAGGCAGAAAAGGGGTG TGG (reversed) Intergenic