ID: 1122794994

View in Genome Browser
Species Human (GRCh38)
Location 14:104201590-104201612
Sequence CGTGGACTGAGGCAGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794994_1122795006 29 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794994_1122794998 -8 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122794998 14:104201605-104201627 AGTCCACGTGCCGCCGATACAGG No data
1122794994_1122795004 19 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122794994_1122795001 2 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794994_1122795005 25 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794994_1122795003 7 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794994 Original CRISPR CGTGGACTGAGGCAGAAAAG GGG (reversed) Intergenic