ID: 1122794995

View in Genome Browser
Species Human (GRCh38)
Location 14:104201591-104201613
Sequence ACGTGGACTGAGGCAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794995_1122795001 1 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794995_1122794998 -9 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122794998 14:104201605-104201627 AGTCCACGTGCCGCCGATACAGG No data
1122794995_1122795005 24 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG 0: 1
1: 0
2: 1
3: 33
4: 256
1122794995_1122795004 18 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG 0: 1
1: 0
2: 0
3: 18
4: 186
1122794995_1122795006 28 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794995_1122795003 6 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794995 Original CRISPR ACGTGGACTGAGGCAGAAAA GGG (reversed) Intergenic