ID: 1122794996

View in Genome Browser
Species Human (GRCh38)
Location 14:104201592-104201614
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794996_1122795006 27 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794996_1122795005 23 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794996_1122794998 -10 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122794998 14:104201605-104201627 AGTCCACGTGCCGCCGATACAGG No data
1122794996_1122795004 17 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122794996_1122795001 0 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794996_1122795003 5 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794996 Original CRISPR CACGTGGACTGAGGCAGAAA AGG (reversed) Intergenic