ID: 1122794997

View in Genome Browser
Species Human (GRCh38)
Location 14:104201601-104201623
Sequence TATCGGCGGCACGTGGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794997_1122795003 -4 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795003 14:104201620-104201642 GATACAGGACTCTGCAGGACAGG No data
1122794997_1122795004 8 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122794997_1122795010 25 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122794997_1122795006 18 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794997_1122795001 -9 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794997_1122795005 14 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794997 Original CRISPR TATCGGCGGCACGTGGACTG AGG (reversed) Intergenic