ID: 1122794999

View in Genome Browser
Species Human (GRCh38)
Location 14:104201608-104201630
Sequence AGTCCTGTATCGGCGGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794999_1122795014 29 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795014 14:104201660-104201682 GCTGGTCTGTGGTTCCTGCCTGG No data
1122794999_1122795010 18 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122794999_1122795005 7 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794999_1122795004 1 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122794999_1122795006 11 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122794999 Original CRISPR AGTCCTGTATCGGCGGCACG TGG (reversed) Intergenic