ID: 1122795001

View in Genome Browser
Species Human (GRCh38)
Location 14:104201615-104201637
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794990_1122795001 12 Left 1122794990 14:104201580-104201602 CCCCGCCACACCCCTTTTCTGCC No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794989_1122795001 13 Left 1122794989 14:104201579-104201601 CCCCCGCCACACCCCTTTTCTGC No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794995_1122795001 1 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794993_1122795001 7 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794997_1122795001 -9 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794992_1122795001 10 Left 1122794992 14:104201582-104201604 CCGCCACACCCCTTTTCTGCCTC No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794996_1122795001 0 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794991_1122795001 11 Left 1122794991 14:104201581-104201603 CCCGCCACACCCCTTTTCTGCCT No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
1122794994_1122795001 2 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795001 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122795001 Original CRISPR CCGCCGATACAGGACTCTGC AGG Intergenic