ID: 1122795002

View in Genome Browser
Species Human (GRCh38)
Location 14:104201618-104201640
Sequence TGTCCTGCAGAGTCCTGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122795002_1122795015 25 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795015 14:104201666-104201688 CTGTGGTTCCTGCCTGGCCTTGG No data
1122795002_1122795004 -9 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG No data
1122795002_1122795010 8 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122795002_1122795014 19 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795014 14:104201660-104201682 GCTGGTCTGTGGTTCCTGCCTGG No data
1122795002_1122795016 26 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795016 14:104201667-104201689 TGTGGTTCCTGCCTGGCCTTGGG No data
1122795002_1122795006 1 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122795002_1122795005 -3 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122795002 Original CRISPR TGTCCTGCAGAGTCCTGTAT CGG (reversed) Intergenic