ID: 1122795005

View in Genome Browser
Species Human (GRCh38)
Location 14:104201638-104201660
Sequence ACAGGCCCCAACTGAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122795000_1122795005 0 Left 1122795000 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794993_1122795005 30 Left 1122794993 14:104201585-104201607 CCACACCCCTTTTCTGCCTCAGT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794997_1122795005 14 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794996_1122795005 23 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794995_1122795005 24 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794994_1122795005 25 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122794999_1122795005 7 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data
1122795002_1122795005 -3 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795005 14:104201638-104201660 ACAGGCCCCAACTGAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122795005 Original CRISPR ACAGGCCCCAACTGAGGCCC CGG Intergenic