ID: 1122795006

View in Genome Browser
Species Human (GRCh38)
Location 14:104201642-104201664
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794996_1122795006 27 Left 1122794996 14:104201592-104201614 CCTTTTCTGCCTCAGTCCACGTG No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122795000_1122795006 4 Left 1122795000 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794995_1122795006 28 Left 1122794995 14:104201591-104201613 CCCTTTTCTGCCTCAGTCCACGT No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794997_1122795006 18 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122795002_1122795006 1 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794994_1122795006 29 Left 1122794994 14:104201590-104201612 CCCCTTTTCTGCCTCAGTCCACG No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data
1122794999_1122795006 11 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122795006 Original CRISPR GCCCCAACTGAGGCCCCGGC TGG Intergenic
No off target data available for this crispr