ID: 1122795010

View in Genome Browser
Species Human (GRCh38)
Location 14:104201649-104201671
Sequence CTGAGGCCCCGGCTGGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122794997_1122795010 25 Left 1122794997 14:104201601-104201623 CCTCAGTCCACGTGCCGCCGATA No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122795000_1122795010 11 Left 1122795000 14:104201615-104201637 CCGCCGATACAGGACTCTGCAGG No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122794999_1122795010 18 Left 1122794999 14:104201608-104201630 CCACGTGCCGCCGATACAGGACT No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data
1122795002_1122795010 8 Left 1122795002 14:104201618-104201640 CCGATACAGGACTCTGCAGGACA No data
Right 1122795010 14:104201649-104201671 CTGAGGCCCCGGCTGGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122795010 Original CRISPR CTGAGGCCCCGGCTGGTCTG TGG Intergenic