ID: 1122796041

View in Genome Browser
Species Human (GRCh38)
Location 14:104206775-104206797
Sequence GTGTGTGTGTGAAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122796037_1122796041 9 Left 1122796037 14:104206743-104206765 CCCATGGATGGACACACACAGTG No data
Right 1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG No data
1122796038_1122796041 8 Left 1122796038 14:104206744-104206766 CCATGGATGGACACACACAGTGT No data
Right 1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122796041 Original CRISPR GTGTGTGTGTGAAGGGAAGC AGG Intergenic
No off target data available for this crispr