ID: 1122799690

View in Genome Browser
Species Human (GRCh38)
Location 14:104223393-104223415
Sequence GGGGTGGGGGCGGGGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799690_1122799706 14 Left 1122799690 14:104223393-104223415 CCTGCCGCCCCCGCCCCCACCCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799690_1122799709 24 Left 1122799690 14:104223393-104223415 CCTGCCGCCCCCGCCCCCACCCC No data
Right 1122799709 14:104223440-104223462 ACCTCCTGCCTGGGGTGTCCTGG No data
1122799690_1122799708 16 Left 1122799690 14:104223393-104223415 CCTGCCGCCCCCGCCCCCACCCC No data
Right 1122799708 14:104223432-104223454 CTCTGACAACCTCCTGCCTGGGG No data
1122799690_1122799707 15 Left 1122799690 14:104223393-104223415 CCTGCCGCCCCCGCCCCCACCCC No data
Right 1122799707 14:104223431-104223453 TCTCTGACAACCTCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799690 Original CRISPR GGGGTGGGGGCGGGGGCGGC AGG (reversed) Intergenic
No off target data available for this crispr