ID: 1122799700

View in Genome Browser
Species Human (GRCh38)
Location 14:104223412-104223434
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799700_1122799713 17 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799700_1122799715 19 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799715 14:104223454-104223476 GTGTCCTGGAACTGCGCCAGGGG No data
1122799700_1122799709 5 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799709 14:104223440-104223462 ACCTCCTGCCTGGGGTGTCCTGG No data
1122799700_1122799706 -5 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799700_1122799716 20 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799700_1122799707 -4 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799707 14:104223431-104223453 TCTCTGACAACCTCCTGCCTGGG No data
1122799700_1122799718 26 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799700_1122799714 18 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799714 14:104223453-104223475 GGTGTCCTGGAACTGCGCCAGGG No data
1122799700_1122799708 -3 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799708 14:104223432-104223454 CTCTGACAACCTCCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799700 Original CRISPR GAGAAAGGAGGAGGCAGCTG GGG (reversed) Intergenic
No off target data available for this crispr