ID: 1122799703

View in Genome Browser
Species Human (GRCh38)
Location 14:104223421-104223443
Sequence AGGTTGTCAGAGAAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799703_1122799716 11 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799703_1122799713 8 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799703_1122799715 10 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799715 14:104223454-104223476 GTGTCCTGGAACTGCGCCAGGGG No data
1122799703_1122799709 -4 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799709 14:104223440-104223462 ACCTCCTGCCTGGGGTGTCCTGG No data
1122799703_1122799714 9 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799714 14:104223453-104223475 GGTGTCCTGGAACTGCGCCAGGG No data
1122799703_1122799718 17 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799703_1122799720 26 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799720 14:104223470-104223492 CCAGGGGGACCAGGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799703 Original CRISPR AGGTTGTCAGAGAAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr