ID: 1122799706

View in Genome Browser
Species Human (GRCh38)
Location 14:104223430-104223452
Sequence TTCTCTGACAACCTCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799693_1122799706 6 Left 1122799693 14:104223401-104223423 CCCCGCCCCCACCCCAGCTGCCT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799700_1122799706 -5 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799692_1122799706 7 Left 1122799692 14:104223400-104223422 CCCCCGCCCCCACCCCAGCTGCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799698_1122799706 -1 Left 1122799698 14:104223408-104223430 CCCACCCCAGCTGCCTCCTCCTT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799699_1122799706 -2 Left 1122799699 14:104223409-104223431 CCACCCCAGCTGCCTCCTCCTTT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799691_1122799706 10 Left 1122799691 14:104223397-104223419 CCGCCCCCGCCCCCACCCCAGCT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799697_1122799706 0 Left 1122799697 14:104223407-104223429 CCCCACCCCAGCTGCCTCCTCCT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799702_1122799706 -7 Left 1122799702 14:104223414-104223436 CCAGCTGCCTCCTCCTTTCTCTG No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799690_1122799706 14 Left 1122799690 14:104223393-104223415 CCTGCCGCCCCCGCCCCCACCCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799701_1122799706 -6 Left 1122799701 14:104223413-104223435 CCCAGCTGCCTCCTCCTTTCTCT No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799696_1122799706 1 Left 1122799696 14:104223406-104223428 CCCCCACCCCAGCTGCCTCCTCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799694_1122799706 5 Left 1122799694 14:104223402-104223424 CCCGCCCCCACCCCAGCTGCCTC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799695_1122799706 4 Left 1122799695 14:104223403-104223425 CCGCCCCCACCCCAGCTGCCTCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799689_1122799706 27 Left 1122799689 14:104223380-104223402 CCTCTGCAGGCAGCCTGCCGCCC No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data
1122799688_1122799706 30 Left 1122799688 14:104223377-104223399 CCGCCTCTGCAGGCAGCCTGCCG No data
Right 1122799706 14:104223430-104223452 TTCTCTGACAACCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799706 Original CRISPR TTCTCTGACAACCTCCTGCC TGG Intergenic
No off target data available for this crispr