ID: 1122799713

View in Genome Browser
Species Human (GRCh38)
Location 14:104223452-104223474
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799698_1122799713 21 Left 1122799698 14:104223408-104223430 CCCACCCCAGCTGCCTCCTCCTT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799699_1122799713 20 Left 1122799699 14:104223409-104223431 CCACCCCAGCTGCCTCCTCCTTT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799702_1122799713 15 Left 1122799702 14:104223414-104223436 CCAGCTGCCTCCTCCTTTCTCTG No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799704_1122799713 5 Left 1122799704 14:104223424-104223446 CCTCCTTTCTCTGACAACCTCCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799701_1122799713 16 Left 1122799701 14:104223413-104223435 CCCAGCTGCCTCCTCCTTTCTCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799696_1122799713 23 Left 1122799696 14:104223406-104223428 CCCCCACCCCAGCTGCCTCCTCC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799705_1122799713 2 Left 1122799705 14:104223427-104223449 CCTTTCTCTGACAACCTCCTGCC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799697_1122799713 22 Left 1122799697 14:104223407-104223429 CCCCACCCCAGCTGCCTCCTCCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799703_1122799713 8 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799693_1122799713 28 Left 1122799693 14:104223401-104223423 CCCCGCCCCCACCCCAGCTGCCT No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799694_1122799713 27 Left 1122799694 14:104223402-104223424 CCCGCCCCCACCCCAGCTGCCTC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799692_1122799713 29 Left 1122799692 14:104223400-104223422 CCCCCGCCCCCACCCCAGCTGCC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799700_1122799713 17 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data
1122799695_1122799713 26 Left 1122799695 14:104223403-104223425 CCGCCCCCACCCCAGCTGCCTCC No data
Right 1122799713 14:104223452-104223474 GGGTGTCCTGGAACTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799713 Original CRISPR GGGTGTCCTGGAACTGCGCC AGG Intergenic
No off target data available for this crispr