ID: 1122799716

View in Genome Browser
Species Human (GRCh38)
Location 14:104223455-104223477
Sequence TGTCCTGGAACTGCGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799696_1122799716 26 Left 1122799696 14:104223406-104223428 CCCCCACCCCAGCTGCCTCCTCC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799702_1122799716 18 Left 1122799702 14:104223414-104223436 CCAGCTGCCTCCTCCTTTCTCTG No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799700_1122799716 20 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799699_1122799716 23 Left 1122799699 14:104223409-104223431 CCACCCCAGCTGCCTCCTCCTTT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799695_1122799716 29 Left 1122799695 14:104223403-104223425 CCGCCCCCACCCCAGCTGCCTCC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799694_1122799716 30 Left 1122799694 14:104223402-104223424 CCCGCCCCCACCCCAGCTGCCTC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799698_1122799716 24 Left 1122799698 14:104223408-104223430 CCCACCCCAGCTGCCTCCTCCTT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799697_1122799716 25 Left 1122799697 14:104223407-104223429 CCCCACCCCAGCTGCCTCCTCCT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799710_1122799716 -9 Left 1122799710 14:104223441-104223463 CCTCCTGCCTGGGGTGTCCTGGA No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799701_1122799716 19 Left 1122799701 14:104223413-104223435 CCCAGCTGCCTCCTCCTTTCTCT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799703_1122799716 11 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799704_1122799716 8 Left 1122799704 14:104223424-104223446 CCTCCTTTCTCTGACAACCTCCT No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data
1122799705_1122799716 5 Left 1122799705 14:104223427-104223449 CCTTTCTCTGACAACCTCCTGCC No data
Right 1122799716 14:104223455-104223477 TGTCCTGGAACTGCGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799716 Original CRISPR TGTCCTGGAACTGCGCCAGG GGG Intergenic
No off target data available for this crispr