ID: 1122799718

View in Genome Browser
Species Human (GRCh38)
Location 14:104223461-104223483
Sequence GGAACTGCGCCAGGGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122799710_1122799718 -3 Left 1122799710 14:104223441-104223463 CCTCCTGCCTGGGGTGTCCTGGA No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799700_1122799718 26 Left 1122799700 14:104223412-104223434 CCCCAGCTGCCTCCTCCTTTCTC No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799698_1122799718 30 Left 1122799698 14:104223408-104223430 CCCACCCCAGCTGCCTCCTCCTT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799699_1122799718 29 Left 1122799699 14:104223409-104223431 CCACCCCAGCTGCCTCCTCCTTT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799711_1122799718 -6 Left 1122799711 14:104223444-104223466 CCTGCCTGGGGTGTCCTGGAACT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799704_1122799718 14 Left 1122799704 14:104223424-104223446 CCTCCTTTCTCTGACAACCTCCT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799705_1122799718 11 Left 1122799705 14:104223427-104223449 CCTTTCTCTGACAACCTCCTGCC No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799701_1122799718 25 Left 1122799701 14:104223413-104223435 CCCAGCTGCCTCCTCCTTTCTCT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799703_1122799718 17 Left 1122799703 14:104223421-104223443 CCTCCTCCTTTCTCTGACAACCT No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799712_1122799718 -10 Left 1122799712 14:104223448-104223470 CCTGGGGTGTCCTGGAACTGCGC No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data
1122799702_1122799718 24 Left 1122799702 14:104223414-104223436 CCAGCTGCCTCCTCCTTTCTCTG No data
Right 1122799718 14:104223461-104223483 GGAACTGCGCCAGGGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122799718 Original CRISPR GGAACTGCGCCAGGGGGACC AGG Intergenic
No off target data available for this crispr