ID: 1122801273

View in Genome Browser
Species Human (GRCh38)
Location 14:104230824-104230846
Sequence ATGGAGATGAGGCCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122801265_1122801273 1 Left 1122801265 14:104230800-104230822 CCCCACGACTTGATTAAGACCAC No data
Right 1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG No data
1122801266_1122801273 0 Left 1122801266 14:104230801-104230823 CCCACGACTTGATTAAGACCACT No data
Right 1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG No data
1122801267_1122801273 -1 Left 1122801267 14:104230802-104230824 CCACGACTTGATTAAGACCACTA No data
Right 1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122801273 Original CRISPR ATGGAGATGAGGCCTGAGGA GGG Intergenic
No off target data available for this crispr