ID: 1122801975

View in Genome Browser
Species Human (GRCh38)
Location 14:104235603-104235625
Sequence CCTTAAGTGGAGACATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122801967_1122801975 24 Left 1122801967 14:104235556-104235578 CCTTCCTTCTTTCCTCTTTCTGT No data
Right 1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG No data
1122801970_1122801975 12 Left 1122801970 14:104235568-104235590 CCTCTTTCTGTGTTAGGTTTGCA No data
Right 1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG No data
1122801968_1122801975 20 Left 1122801968 14:104235560-104235582 CCTTCTTTCCTCTTTCTGTGTTA No data
Right 1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG No data
1122801966_1122801975 28 Left 1122801966 14:104235552-104235574 CCTTCCTTCCTTCTTTCCTCTTT 0: 24
1: 390
2: 3075
3: 16000
4: 66465
Right 1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122801975 Original CRISPR CCTTAAGTGGAGACATTGAA TGG Intergenic
No off target data available for this crispr