ID: 1122802459

View in Genome Browser
Species Human (GRCh38)
Location 14:104238506-104238528
Sequence CACCTCCTCCCTGTTCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122802456_1122802459 -6 Left 1122802456 14:104238489-104238511 CCTGGGCTTACAGATGCCACCTC No data
Right 1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG No data
1122802452_1122802459 9 Left 1122802452 14:104238474-104238496 CCTCTCTGGCCCCGTCCTGGGCT No data
Right 1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG No data
1122802453_1122802459 0 Left 1122802453 14:104238483-104238505 CCCCGTCCTGGGCTTACAGATGC No data
Right 1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG No data
1122802455_1122802459 -2 Left 1122802455 14:104238485-104238507 CCGTCCTGGGCTTACAGATGCCA No data
Right 1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG No data
1122802454_1122802459 -1 Left 1122802454 14:104238484-104238506 CCCGTCCTGGGCTTACAGATGCC No data
Right 1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122802459 Original CRISPR CACCTCCTCCCTGTTCCTCC GGG Intergenic
No off target data available for this crispr