ID: 1122802555

View in Genome Browser
Species Human (GRCh38)
Location 14:104238951-104238973
Sequence TGCACCGGAGGAGCCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122802540_1122802555 13 Left 1122802540 14:104238915-104238937 CCCTCAGGCCCCCGAGAGTGTGG No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802548_1122802555 2 Left 1122802548 14:104238926-104238948 CCGAGAGTGTGGAGGCCCCTGGC No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802538_1122802555 27 Left 1122802538 14:104238901-104238923 CCAGGCTACGCCTGCCCTCAGGC No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802542_1122802555 12 Left 1122802542 14:104238916-104238938 CCTCAGGCCCCCGAGAGTGTGGA No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802545_1122802555 4 Left 1122802545 14:104238924-104238946 CCCCGAGAGTGTGGAGGCCCCTG No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802544_1122802555 5 Left 1122802544 14:104238923-104238945 CCCCCGAGAGTGTGGAGGCCCCT No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802539_1122802555 17 Left 1122802539 14:104238911-104238933 CCTGCCCTCAGGCCCCCGAGAGT No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data
1122802546_1122802555 3 Left 1122802546 14:104238925-104238947 CCCGAGAGTGTGGAGGCCCCTGG No data
Right 1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122802555 Original CRISPR TGCACCGGAGGAGCCTCTGA TGG Intergenic