ID: 1122804313

View in Genome Browser
Species Human (GRCh38)
Location 14:104248905-104248927
Sequence CTGCAGGCAGAGGTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122804313_1122804320 23 Left 1122804313 14:104248905-104248927 CCCTCCTCAACCTCTGCCTGCAG No data
Right 1122804320 14:104248951-104248973 AAACAATCCCTGCGCTCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122804313 Original CRISPR CTGCAGGCAGAGGTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr