ID: 1122804454

View in Genome Browser
Species Human (GRCh38)
Location 14:104249620-104249642
Sequence CAGAACTACCCTTGAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122804454_1122804465 21 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804465 14:104249664-104249686 CCTCCCCCTGGTGGGACAGAAGG No data
1122804454_1122804458 9 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804458 14:104249652-104249674 TGCCCATGAGACCCTCCCCCTGG No data
1122804454_1122804462 13 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804462 14:104249656-104249678 CATGAGACCCTCCCCCTGGTGGG No data
1122804454_1122804470 28 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG No data
1122804454_1122804461 12 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804461 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122804454 Original CRISPR CAGAACTACCCTTGAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr