ID: 1122804460

View in Genome Browser
Species Human (GRCh38)
Location 14:104249655-104249677
Sequence CCACCAGGGGGAGGGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122804460_1122804470 -7 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG No data
1122804460_1122804474 7 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804474 14:104249685-104249707 GGAGCTAGGAGTGGGAGGCCAGG No data
1122804460_1122804476 9 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804476 14:104249687-104249709 AGCTAGGAGTGGGAGGCCAGGGG No data
1122804460_1122804473 2 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804473 14:104249680-104249702 CAGAAGGAGCTAGGAGTGGGAGG No data
1122804460_1122804475 8 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804475 14:104249686-104249708 GAGCTAGGAGTGGGAGGCCAGGG No data
1122804460_1122804477 12 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804477 14:104249690-104249712 TAGGAGTGGGAGGCCAGGGGAGG No data
1122804460_1122804472 -1 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804472 14:104249677-104249699 GGACAGAAGGAGCTAGGAGTGGG No data
1122804460_1122804471 -2 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804471 14:104249676-104249698 GGGACAGAAGGAGCTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122804460 Original CRISPR CCACCAGGGGGAGGGTCTCA TGG (reversed) Intergenic
No off target data available for this crispr