ID: 1122804470

View in Genome Browser
Species Human (GRCh38)
Location 14:104249671-104249693
Sequence CTGGTGGGACAGAAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122804454_1122804470 28 Left 1122804454 14:104249620-104249642 CCATTCACTCAAGGGTAGTTCTG No data
Right 1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG No data
1122804460_1122804470 -7 Left 1122804460 14:104249655-104249677 CCATGAGACCCTCCCCCTGGTGG No data
Right 1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG No data
1122804459_1122804470 -6 Left 1122804459 14:104249654-104249676 CCCATGAGACCCTCCCCCTGGTG No data
Right 1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122804470 Original CRISPR CTGGTGGGACAGAAGGAGCT AGG Intergenic
No off target data available for this crispr