ID: 1122805325

View in Genome Browser
Species Human (GRCh38)
Location 14:104253520-104253542
Sequence GCTGGAGAACGCGGGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122805325_1122805335 20 Left 1122805325 14:104253520-104253542 CCAAAGCTCCCGCGTTCTCCAGC No data
Right 1122805335 14:104253563-104253585 GCTGTCCAGCCGAGTTCTGATGG No data
1122805325_1122805337 26 Left 1122805325 14:104253520-104253542 CCAAAGCTCCCGCGTTCTCCAGC No data
Right 1122805337 14:104253569-104253591 CAGCCGAGTTCTGATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122805325 Original CRISPR GCTGGAGAACGCGGGAGCTT TGG (reversed) Intergenic