ID: 1122805991 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:104257342-104257364 |
| Sequence | TCTTGCTTATTGCAGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122805991_1122805995 | 13 | Left | 1122805991 | 14:104257342-104257364 | CCTTCCACCTGCAATAAGCAAGA | No data | ||
| Right | 1122805995 | 14:104257378-104257400 | ACATGAAAAATCAGTTCTCAAGG | No data | ||||
| 1122805991_1122805996 | 28 | Left | 1122805991 | 14:104257342-104257364 | CCTTCCACCTGCAATAAGCAAGA | No data | ||
| Right | 1122805996 | 14:104257393-104257415 | TCTCAAGGCACTGTAGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122805991 | Original CRISPR | TCTTGCTTATTGCAGGTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||