ID: 1122805991

View in Genome Browser
Species Human (GRCh38)
Location 14:104257342-104257364
Sequence TCTTGCTTATTGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122805991_1122805995 13 Left 1122805991 14:104257342-104257364 CCTTCCACCTGCAATAAGCAAGA No data
Right 1122805995 14:104257378-104257400 ACATGAAAAATCAGTTCTCAAGG No data
1122805991_1122805996 28 Left 1122805991 14:104257342-104257364 CCTTCCACCTGCAATAAGCAAGA No data
Right 1122805996 14:104257393-104257415 TCTCAAGGCACTGTAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122805991 Original CRISPR TCTTGCTTATTGCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr