ID: 1122806539

View in Genome Browser
Species Human (GRCh38)
Location 14:104262849-104262871
Sequence CCCTTCCAAAGTACACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122806539_1122806545 -1 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806545 14:104262871-104262893 GAAGTGGCATCCCGGGTGTCAGG No data
1122806539_1122806551 15 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806551 14:104262887-104262909 TGTCAGGGCCCCCCACCCTGGGG No data
1122806539_1122806543 -9 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806543 14:104262863-104262885 TTGGAAGGGAAGTGGCATCCCGG No data
1122806539_1122806552 21 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806552 14:104262893-104262915 GGCCCCCCACCCTGGGGCAGAGG No data
1122806539_1122806546 0 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806546 14:104262872-104262894 AAGTGGCATCCCGGGTGTCAGGG No data
1122806539_1122806555 24 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806555 14:104262896-104262918 CCCCCACCCTGGGGCAGAGGAGG No data
1122806539_1122806550 14 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806539_1122806549 13 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806549 14:104262885-104262907 GGTGTCAGGGCCCCCCACCCTGG No data
1122806539_1122806544 -8 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806544 14:104262864-104262886 TGGAAGGGAAGTGGCATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122806539 Original CRISPR CCCTTCCAAAGTACACTGGC TGG (reversed) Intergenic