ID: 1122806541

View in Genome Browser
Species Human (GRCh38)
Location 14:104262853-104262875
Sequence ACTTCCCTTCCAAAGTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122806541_1122806550 10 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806541_1122806545 -5 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806545 14:104262871-104262893 GAAGTGGCATCCCGGGTGTCAGG No data
1122806541_1122806551 11 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806551 14:104262887-104262909 TGTCAGGGCCCCCCACCCTGGGG No data
1122806541_1122806552 17 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806552 14:104262893-104262915 GGCCCCCCACCCTGGGGCAGAGG No data
1122806541_1122806555 20 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806555 14:104262896-104262918 CCCCCACCCTGGGGCAGAGGAGG No data
1122806541_1122806549 9 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806549 14:104262885-104262907 GGTGTCAGGGCCCCCCACCCTGG No data
1122806541_1122806546 -4 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806546 14:104262872-104262894 AAGTGGCATCCCGGGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122806541 Original CRISPR ACTTCCCTTCCAAAGTACAC TGG (reversed) Intergenic