ID: 1122806550

View in Genome Browser
Species Human (GRCh38)
Location 14:104262886-104262908
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122806536_1122806550 16 Left 1122806536 14:104262847-104262869 CCCCAGCCAGTGTACTTTGGAAG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806541_1122806550 10 Left 1122806541 14:104262853-104262875 CCAGTGTACTTTGGAAGGGAAGT No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806537_1122806550 15 Left 1122806537 14:104262848-104262870 CCCAGCCAGTGTACTTTGGAAGG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806533_1122806550 20 Left 1122806533 14:104262843-104262865 CCCACCCCAGCCAGTGTACTTTG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806534_1122806550 19 Left 1122806534 14:104262844-104262866 CCACCCCAGCCAGTGTACTTTGG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data
1122806539_1122806550 14 Left 1122806539 14:104262849-104262871 CCAGCCAGTGTACTTTGGAAGGG No data
Right 1122806550 14:104262886-104262908 GTGTCAGGGCCCCCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122806550 Original CRISPR GTGTCAGGGCCCCCCACCCT GGG Intergenic
No off target data available for this crispr