ID: 1122809491

View in Genome Browser
Species Human (GRCh38)
Location 14:104281022-104281044
Sequence CCTGCGGGGCAGGTTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122809491_1122809501 13 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809501 14:104281058-104281080 TCCTGCCTGTCCTGGATCCCAGG No data
1122809491_1122809500 5 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809500 14:104281050-104281072 GCTGAAGGTCCTGCCTGTCCTGG No data
1122809491_1122809504 19 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809504 14:104281064-104281086 CTGTCCTGGATCCCAGGCCGTGG No data
1122809491_1122809506 29 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809506 14:104281074-104281096 TCCCAGGCCGTGGAGACGCGCGG No data
1122809491_1122809508 30 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809491_1122809496 -10 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809496 14:104281035-104281057 GCCCCGCAGGGCAGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122809491 Original CRISPR CCTGCGGGGCAGGTTGGCCT AGG (reversed) Intergenic
No off target data available for this crispr