ID: 1122809497

View in Genome Browser
Species Human (GRCh38)
Location 14:104281036-104281058
Sequence ACCTTCAGCTCTGCCCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122809497_1122809511 24 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809511 14:104281083-104281105 GTGGAGACGCGCGGGAAGAGAGG No data
1122809497_1122809501 -1 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809501 14:104281058-104281080 TCCTGCCTGTCCTGGATCCCAGG No data
1122809497_1122809506 15 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809506 14:104281074-104281096 TCCCAGGCCGTGGAGACGCGCGG No data
1122809497_1122809508 16 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809497_1122809512 30 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809512 14:104281089-104281111 ACGCGCGGGAAGAGAGGCTGTGG No data
1122809497_1122809500 -9 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809500 14:104281050-104281072 GCTGAAGGTCCTGCCTGTCCTGG No data
1122809497_1122809504 5 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809504 14:104281064-104281086 CTGTCCTGGATCCCAGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122809497 Original CRISPR ACCTTCAGCTCTGCCCTGCG GGG (reversed) Intergenic
No off target data available for this crispr