ID: 1122809499

View in Genome Browser
Species Human (GRCh38)
Location 14:104281038-104281060
Sequence GGACCTTCAGCTCTGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122809499_1122809511 22 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809511 14:104281083-104281105 GTGGAGACGCGCGGGAAGAGAGG No data
1122809499_1122809501 -3 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809501 14:104281058-104281080 TCCTGCCTGTCCTGGATCCCAGG No data
1122809499_1122809512 28 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809512 14:104281089-104281111 ACGCGCGGGAAGAGAGGCTGTGG No data
1122809499_1122809504 3 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809504 14:104281064-104281086 CTGTCCTGGATCCCAGGCCGTGG No data
1122809499_1122809506 13 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809506 14:104281074-104281096 TCCCAGGCCGTGGAGACGCGCGG No data
1122809499_1122809508 14 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122809499 Original CRISPR GGACCTTCAGCTCTGCCCTG CGG (reversed) Intergenic
No off target data available for this crispr