ID: 1122809502

View in Genome Browser
Species Human (GRCh38)
Location 14:104281059-104281081
Sequence GCCTGGGATCCAGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122809502_1122809508 -7 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809502_1122809512 7 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809512 14:104281089-104281111 ACGCGCGGGAAGAGAGGCTGTGG No data
1122809502_1122809516 28 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809516 14:104281110-104281132 GGTAGGCAGAGTTCAGGTCTGGG No data
1122809502_1122809506 -8 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809506 14:104281074-104281096 TCCCAGGCCGTGGAGACGCGCGG No data
1122809502_1122809517 29 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809517 14:104281111-104281133 GTAGGCAGAGTTCAGGTCTGGGG No data
1122809502_1122809511 1 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809511 14:104281083-104281105 GTGGAGACGCGCGGGAAGAGAGG No data
1122809502_1122809514 22 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809514 14:104281104-104281126 GGCTGTGGTAGGCAGAGTTCAGG No data
1122809502_1122809513 11 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809513 14:104281093-104281115 GCGGGAAGAGAGGCTGTGGTAGG No data
1122809502_1122809515 27 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809515 14:104281109-104281131 TGGTAGGCAGAGTTCAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122809502 Original CRISPR GCCTGGGATCCAGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr