ID: 1122809508

View in Genome Browser
Species Human (GRCh38)
Location 14:104281075-104281097
Sequence CCCAGGCCGTGGAGACGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122809494_1122809508 24 Left 1122809494 14:104281028-104281050 CCAACCTGCCCCGCAGGGCAGAG No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809502_1122809508 -7 Left 1122809502 14:104281059-104281081 CCTGCCTGTCCTGGATCCCAGGC No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809497_1122809508 16 Left 1122809497 14:104281036-104281058 CCCCGCAGGGCAGAGCTGAAGGT No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809499_1122809508 14 Left 1122809499 14:104281038-104281060 CCGCAGGGCAGAGCTGAAGGTCC No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809491_1122809508 30 Left 1122809491 14:104281022-104281044 CCTAGGCCAACCTGCCCCGCAGG No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809495_1122809508 20 Left 1122809495 14:104281032-104281054 CCTGCCCCGCAGGGCAGAGCTGA No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data
1122809498_1122809508 15 Left 1122809498 14:104281037-104281059 CCCGCAGGGCAGAGCTGAAGGTC No data
Right 1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122809508 Original CRISPR CCCAGGCCGTGGAGACGCGC GGG Intergenic
No off target data available for this crispr